Bioinformatica con penna e carta: costruire un albero filogenetico Teach article

Tradotto da Monica Menesini. La Bioinformatica in generale richiede potenti computer; con l’aiuto di Cleopatra Kozlowski potrete invece investigare il nostro antenato primate armati soltanto di carta e penna.

Per gentile concessione di
hometowncd / iStockphoto

In seguito agli ultimi sviluppi tecnologici, è relativamente semplice e veloce determinare una sequenza di DNA o di una proteina. Queste sequenze tuttavia di per sé ci dicono ben poco: GAATCCA, per esempio. Abbiamo bisogno di conoscere il significato delle sequenza. Quali proteine sono codificate da quella sequenza di DNA? O la sequenza, invece, non codifica per una proteina? Che effetti avrà un piccolo cambiamento nel DNA sulla struttura della proteina? Che funzione svolge quell proteina nella cellula? E, naturalmente, cosa ci può dire quella certa sequenza di DNA sulla nostra storia evolutiva?

Queste ed altre importanti questioni possono essere risolte con la bioinformatica, essenzialmente paragonando le sequenza di DNA o di proteine – per esempio paragonando una sequenza scoperta da poco con sequenze per le quali abbiamo già molte informazioni (forse hanno la stessa funzione?) o paragonando sequenze simili in specie diverse.

La bioinformatica generalmente richiede l’uso di potenti computer. E’ troppo semplice però lasciar fare al computer tutto il lavoro senza comprendere cosa c’è sotto. Per questo motivo, queste attività sono progettate per essere svolte su carta, in modo che gli studenti capiscano come funziona l’analisi bioinformatica.

Questo articolo riguarda una di un gruppo di quattro attività. Le due attività introduttive (“trovare un gene” e “mutazioni”) e quella conclusiva (“DNA mobile”) possono essere scaricate dal sito dell’European Learning Laboratory for the Life Sciences (ELLS)w1. Tutte le tabelle necessarie agli studenti per completare questa attività, la procedura in dettaglio e le risposte alle domande di comprensione possono essere scaricate dal sito di Science in Schoolw2.

Costruire un albero filogenetico

L’accumulo di mutazioni produce cambiamenti del DNA nel corso delle generazioni. Questa attività dimostra come questo possa essere utilizzato per dedurre le relazioni evolutive tra gli organismi. Richiede circa 90 minuti e fa uso solo di penna e tabelle scaricabili dal sito di Science in Schoolw2.

Introduzione

Haeckel’s tree of life from
The Evolution of Man (1879).
Cliccare sull’immagine per
ingrandirla

Public domain image; image
source: Wikimedia Commons

Pensate a come classifichereste diversi animali. Tradizionalmente sono state usate le differenze fisiche per determinare le relazioni evolutive tra di loro, per esempio se l’organismo ha una colonna vertebrale o se ha le ali. Questo approccio però può causare dei problemi. Per esempio gli uccelli, i pipistelli e gli insetti hanno le ali, ma sono strettamente imparentati? Come si misura il tempo trascorso dalla divergenza rispetto all’antenato comune?

Sappiamo dagli studi di sequenziamento del DNA che le mutazioni avvengono casualmente ad un ritmo molto lento e vengono trasmesse dai genitori alla prole. Così, se assumiamo che tutti gli organismi hanno un antenato comune, si possono usare le differenze nelle sequenze omologhe per misurare quanto tempo è passato da quando gli organismi si sono separati. In altre parole, più lontano nel tempo è il momento della divergenze, più le sequenze di DNA saranno diverse.

Le sequenze omologhe sono quelle sequenze che hanno un’origine comune. In realtà non possiamo sapere con certezza se due sequenze sono omologhe (non eravamo lì a vedere il DNA cambiare nel tempo) ma se sono sufficientemente simili possiamo assumere che siano omologhe. Per determinare quanto simili sono due sequenze, vanno allineate correttamente (ma questo non fa parte di questa attività).

Da notare che regioni diverse del DNA – codificanti e non codificanti – evolvono a velocità diverse. In generale, le regioni codificanti evolvono più lentamente, perché una mutazione che produce un cambiamento in una proteina è  generalmente più dannosa per l’organismo che quindi ha meno probabilità di sopravvivere e riprodursi. Questo è discusso nell’attivita “DNA mobile”.

Per illustrare il concetto di omologia si può usare l’esempio della filologia – lo studio dell’evoluzione delle lingue. Ci sono infatti molti parallelismi tra i metodi usati per studiare l’evoluzione delle lingue e degli organismi.

Figura 1: L’albero delle lingue Indoeuropee. Nortare che sebbene l’Indiano, il Germanico e il Romancio e molte altre lingue Europee appartengano a questa famiglia, il Finlandese, l’Estone e l’Ungherese non ne fanno parte : esse appartengono al gruppo linguistico Uralico. Cliccare sull’immagine per ingrandirla
Fonte dei dati: www.linguatics.com/indoeuropean_languages.htm

Usare le differenze tra frammenti di sequenze di DNA è un po’ come paragonare una parola che ha lo stesso significato nelle varie lingue, per scoprire quanto strettamente sono imparentate.

Tabella 1: lista di “gatto” nelle lingue indo-europee
Fonte dei dati: http://cats-cat.blogspot.com
Armeno gatz
Basco katu
Olandese kat
Inglese cat
Estone kass
Finlandese kissa
Islandese kottur
Italiano gatto
Norvegese katt
Polacco kot
Portoghese gato
Russo kot
Spagnolo gato
Svedese katt

Si può notare che la parola “gatto” in Italiano, Spagnolo e Portoghese è più o meno la stessa: gatto, gato e gato. Sia in Svedese che in Norvegese la parola è “katt”, ma in Finlandese è diversa: “kissa”. Sebbene la Finlandia, così come la Svezia e la Norvegia, sia un paese Nordico, il termine Finlandese per “gatto” è più simile al termine Estone, “kass. Infatti le due lingue sono strettamente legate. Si può quindi imparare qualcosa sulla relazione tra le lingue studiando come le parole sono cambiate nel tempo.

Per gentile concessione di
Stephan Franz Xaver Dietl /
pixelio.de

Costruire un albero filogenetico dei primati

In questa attività costruiremo un albero filogenetico utilizzando 5 sequenze omologhe di DNA di primati. Poiché le sequenze sono fittizie, non possiamo ricavare una stima sicura della distanza genetica; per farlo avremmo bisogno di usare sequenze molto più lunghe. Nonostante ciò, le sequenze finte (in tabella 2) sono state scelte per fornire un quadro sufficientemente accurato delle relazioni tra primati.

Nota: tutte le tabelle necessarie per il completamento di questa attività da parte degli studenti possono essere scaricati dal sito Science in Schoolw2.

Primate Sequenza
Tabella 2: Cinque sequenze di DNA dei primati
Neanderthal (n) TGGTCCTGCAGTCCTCTCCTGGCGCCCCGGGCGCGAGCGGTTGTCC
Uomo (h) TGGTCCTGCTGTCCTCTCCTGGCGCCCTGGGCGCGAGCGGATGTCC
Scimpanzé (c) TGATCCTGCAGTCCTCTTCTGGCGCCCTGGGCGCGTGCGGTTGTCC
Gorilla (g) TGGACCTGCAGTCATCTTCTGCCCGCCCGAGCGCTTGCCGATGTCC
Orangutan (o) ACAACCTGCACTCCTATTCTGCCGAGCCGGGCGCGTGGCAAAGTCC
  1. Contare il numero di differenze tra ogni coppia di sequenze, riportando i dati nella tabella 4. Per esempio, Neanderthal e Uomo differiscono per 3 nucleotidi della sequenza (Tabella 3a), mentre Scimpanzé e Gorilla differiscono per 11 nucleotidi (Tabella 3b)
Tabella 3a: Confronto delle sequenze di Neanderthal e Uomo
Neanderthal TGGTCCTGCAGTCCTCTCCTGGCGCCCCGGGCGCGAGCGGTTGTCC
Uomo TGGTCCTGCTGTCCTCTCCTGGCGCCCTGGGCGCGAGCGGATGTCC
Tabella 3b: Confronto delle sequenze di Scimpanzé e Gorilla
Scimpanzé TGATCCTGCAGTCCTCTTCTGGCGCCCTGGGCGCGTGCGGTTGTCC
Gorilla TGGACCTGCAGTCATCTTCTGCCCGCCCGAGCGCTTGCCGATGTCC

Le tabelle di confronto di tutte le coppie di specie e la tabella completa delle differenze (Tabella 4) possono essere scaricate dal sito Science in Schoolw2.

Neanderthal Uomo Scimpanzé Gorilla Orangutan
Tabella 4: Differenze nelle sequenze dei primati
Neanderthal 0 3      
Uomo 3 0      
Scimpanzé     0 11  
Gorilla     11 0  
Orangutan          

Il numero delle differenze fra due sequenze diviso per il numero totale di nucleotidi in ogni sequenza (in questo caso 46) ci fornisce il dato relativo alla distanza proporzionale tra le due sequenze

  1. Consideriamo le due specie con le sequenze più simili: Neanderthal e Uomo. Nella tabella 5, registrare il numero di nucleotidi che differiscono (3) e la differenza proporzionale (3/46 = 0.065).
Differenze Differenza proporzionale
Tabella 5: distanze evolutive tra antenati dei primati e primati
Neanderthal e Uomo 3 3/46 = 0.065
Neanderthal/Uomo e Scimpanzé    
Neanderthal/ Uomo/ Scimpanzé e Gorilla    
Neanderthal/ Uomo/ Scimpanzé/ Gorilla e Orangutan    

La “sequenza media”tra due specie viene presa come sequenza dell’antenato comune. In questo esercizio, non calcoliamo direttamente la sequenza media di, per esempio, Neandetthal e Uomo, ma la distanza evolutiva tra l’antenato comune di Neanderthal e Uomo e tutti gli altri primati del gruppo.

  1. Calcolare la distanza tra la sequenza media del Neanderthal e dell’Uomo e le altre specie di primati e inserire il dato nella tabella 6a
    Ci sono quattro differenze tra Neanderthal e Scimpanzé e cinque differenze tra Uomo e Scimpanzé. Quindi la distanza media tra Neandertal/Uomo e Scimpanzè é è 4.5.
    Ci sono 11 differenze tra Neanderthal e Gorilla, e 12 tra Uomo e Gorilla. Quindi la distanza media tra Neandertal/Uomo e Gorilla é è 11.5.
  Neanderthal/ Uomo Scimpanzé Gorilla Orangutan
Tabella 6a: Differenze tra le sequenze dell’anenato comune Neanderthal/Uomo e altri primati
Neanderthal/ Uomo 0 (4+5)/2 = 4.5 (11+12)/2=11.5  
Scimpanzé (4+5)/2 = 4.5 0    
Gorilla (11+12)/2=11.5   0  
Orangutan        
  1. Come prima, la distanza si può trasformare in differenze proporzionali dividendo per il numero di nucleotidi in ogni sequenza (46). Calcolare la distanza proporzionale tra la sequenza media Neanderthal/Uomo e le altre specie di primati. Riportare il risultato nella Tabella 5.
    Per lo Scimpanzé, la distanza proporzionale dall’antenato Neanderthal/Uomo è .5/46 = 0.98.

Usando la Tabella 5, cominciare a costruire l’albero evolutivo

  1. Congiungere Neanderthal e Uomo con una linea. La lunghezza della ramificazione deve corrispondere al tempo necessario per l’Uomo e per il Neanderthal per divergere dal loro antenato comune.
    Presumiamo che ci vogliano 20 milioni di anni per il cambiamento di un nucleotide in questa particolare sequenza di DNA. Perciò per cambiare di 0.065 saranno necessari 0.065*20 milioni = 1.3 milioni di anni. La ramificazione deve quindi misurare 1.3 milioni di anni sulla scala del tempo (vedi Figura 2).
  2. Per calcolare quanto tempo fa l’antenato dello Scimpanzè si è separato dall’antenato dell’Uomo (la lunghezza del ramo), sommare le differenze proporzionali della Tabella 5.
    Ricordare che la distanza proporzionale tra l’antenato Neanderthal/Uomo e lo Scimpanzé era 0,98. Quindi il tempo relativo alla divergenza di Scimpanzé, Uomo e Neanderthal dal loro antenato comune è:
    (0.065 + 0.098) * 20 million
    = 0.163 * 20 million
    = 3.3 million years ago.
Figura 2 : Albero filogenetico incompleto
Immagine gentilmente concessa da Nicola Graf
  1. Continuare i calcoli. Ripetere i passaggi …. A ….. per calcolare quanto tempo fa l’antenato Neanderthal/Uomo/Scimpanzé si è separato da Gorilla e Orangutan. Poi calcolare quanto tempo fa l’antenato Neanderthal/Uomo/Scimpanzé/Gorilla si è separato dall’Orangutan. Riportare i risultati nella Tabella 5.
    Se avete bisogno di aiuto, potete scaricare la procedura passo a passo dal sito Science in School.
  2. Usate la tabella 5 completa per terminare l’albero filogenetico, come mostrato sotto.
Figura 3: Albero filogenetico completo
Immagine gentilmente concessa da Nicola Graf

Domande

Di seguito alcune domande da usare per valutare la comprensione dell’attività da parte degli studenti. Le risposte possono essere scaricate dal sito Science in Schoolw2.

  1. Nel vostro albero filogenetico, quanti anni fa Gorilla e Uomo si sono saparati dal loro antenato comune? E Orangutan e Uomo?
  2. Potete stabilire se questo dato e gli altri stimati nel vostro albero sono corretti?
  3. Perché alberi filogenetici costruiti sulla base di regioni diverse del DNA sono diversi?
  4. Quali regioni del DNA si potrebbero usare per paragonare organismi che sono strettamente imparentati?
  5. Che tipo di geni si potrebbero usare per paragonare organismi che sono evolutivamente distanti gli uni dagli altri?
  6. Cosa potremmo fare se, nel paragonare due sequenze, una di esse presentasse interruzioni dovute a delezioni (o inserzioni nell’altra sequenza)?
  7. Puoi spiegare perché questo metodo che semplicemente paragona il numero di differenze tra i nucleotidi potrebbe non funzionare nel caso di organismi molto diversi? Ricorda che stiamo assumendo che ci vogliano 20 milioni di anni perché un nucleotide in una sequenza muti.
  8. Puoi spiegare le ragioni per le quali questo metodo non è così efficace nel determinare le distanze evolutive? Che semplificazioni abbiamo fatto?
  9. Puoi spiegare perché, nel caso si paragonino organismi più distanti, è più opportuno paragonare le sequenze di aminoacidi che le sequenze di DNA?
  10. In questo esercizio ci siamo concentrati su quando le cinque specie di primati si sono separate l’una dall’altra (la scala dell’albero). Spesso tuttavia non conosciamo neppure l’ordine secondo il quale le specie si sono separate (la forma dell’albero). Come sappiamo, ad esempio, che Uomo e Scimpanzé sono più strettamente imparentati di Gorilla e Scimpanzé? Se quest’ultimo caso fosse vero, come sarebbere le differenze tra le sequenze (Tabella 4)?

Ringraziamenti

Questa attività è stata sviluppata in collaborazione tra l’ European Learning Laboratory for the Life Sciences (ELLS)w1 e l’ European Molecular Biology Laboratory’s E-STAR Fellows per produrre risorse didattiche per le scuole. Cleopatra Kozlowski ha usufruito di una borsa di studio E-STAR finanziata da European Commission’s Framework Programme 6 Marie Curie Host Fellowship for Early Stage Research Training, contratto n. MEST-CT-2004-504640.

Download

Download this article as a PDF

Web References

  • w1 – L’ European Learning Laboratory for the Life Sciences (ELLS) è una struttura educativa che fa lavorare gli insegnanti di scuola secondaria nei laboratori di ricerca per un incontro pratico con le più aggiornate tecniche di biologia molecolare. ELLS fornisce anche ai ricercatori l’opportunità di lavorare con gli insegnanti, colmando la distanza sempre più ampia tra ricerca e scuola. L’attività descritta in questo articolo è stata sviluppata come risorsa didattica nell’ambito del programma ELLS di sviluppo professionale per gli insegnanti europei. Per ulteriori informazioni su ELLS, vedere: www.embl.org/ells
  • w2 – Scaricare tutte le tabelle necessaie agli studenti per completare questa attività, insieme con la procedura dettagliata e le risposte alle domande di conprensione qui.

Resources

Institution

EMBL

Review

Quando pensiamo alla bioinformatica probabilmente immaginiamo potenti computer e macchine sequenziatrici, ma i metodi di questa nuova scienza possono essere presentati in classe attraverso semplici attività da svolgere con carta e penna, come fa Cleopatra Kozlowski in questo articolo.

L’autrice ci sfida con la costruzione dell’albero filogenetico degli umani e altri primati sulla base delle differenze genetiche fra brevi sequenze (false) di DNA. L’attività proposta può essere sfruttata in modo divertente nelle scuole secondarie per affrontare alcune tematiche biologiche complesse come gli orologi molecolari nello studio dell’evoluzione.

L’articolo è rivolto agli insegnanti di scienze, che troveranno utili esercizi di comprensione alla fine del testo; gli studenti potranno utilizzare le domande per approfondire la loro comprensione dell’argomento. Le fonti sul web forniscono ulteriori informazioni e risorse.


Giulia Realdon, Italia




License

CC-BY-NC-SA