Bioinformatik mit Stift und Papier: wie man einen phylogenetischen Stammbaum aufstellt Teach article

Übersetzt von Hildegard Kienzle-Pfeilsticker. Bioinformatik wird üblicher weise an einem leistungsstarken Computer betrieben. Cleopatra Kozlowski jedoch verhilft uns dazu, unsere Primaten-Vorfahren zu erforschen – ausgerüstet nur mit einem Stift und Papier.

Mit freundlicher Genehmigung
von hometowncd / iStockphoto

Dank neuer technologischer Fortschritte kann man eine DNA-Sequenz oder eine Proteinsequenz relativ schnell und einfach bestimmen. Natürlich sagen uns diese Sequenzen allein sehr wenig: GAATCCA, zum Beispiel. Wir müssen wissen, was diese Sequenzen bedeuten. Welche Proteine werden durch diese DNA-Sequenz codiert; codiert die Sequenz überhaupt für ein Protein? Welchen Effekt hat eine kleine Änderung in der DNA-Sequenz auf die Struktur des codierten Proteins? Welche Funktion hat das Protein in der Zelle? Und, natürlich, was sagt uns die DNA-Sequenz über die Geschichte unserer Evolution?

Diese und andere wichtige biologische Fragestellungen können mit Hilfe der Bioinformatik angegangen werden: im Wesentlichen durch den Vergleich von DNA- oder Proteinsequenzen – zum Beispiel durch den Vergleich neu entdeckter Sequenzen mit Sequenzen, zu denen uns schon viele Informationen vorliegen (haben sie vielleicht eine ähnliche Funktion?) oder indem wir ähnliche Sequenzen aus verschiedenen Spezies vergleichen.

Natürlich wird Bioinformatik üblicherweise mit Hilfe eines leistungsstarken Computers betrieben. Man macht es sich jedoch zu einfach, wenn man einen Computer die ganze Arbeit machen lässt, ohne die zu Grunde liegenden Prinzipien zu verstehen. Deshalb sind diese Aufgaben so angelegt, dass sie auf einem Stück Papier ausgeführt werden können, damit die Schüler verstehen, wie eine bioinformatische Analyse funktioniert.

Dieser Artikel enthält eine aus einer Gruppe von vier Unterrichtsaktivitäten. Die zwei einführenden („Auffindung von Genen“ und „Mutationen“) und die abschließende Unterrichtsaktivität („Mobile DNA“) können von der Webseite des „European Learning Laboratory for the Life Sciences“ (ELLS)w1 heruntergeladen werden. Alle nötigen Tabellen zur Vervollständigung dieser Aufgabe können, zusammen mit der Schritt-für-Schritt-Anleitung und den Antworten der Verständnisfragen von der Science- in-School-Webseite heruntergeladen werdenw2.

Die Erstellung eines phylogenetischen Stammbaumes

Die Akkumulierung von Mutationen ist die Ursache für DNA-Sequenzänderungen über Generationen hinweg. Die folgende Unterrichtsaktivität zeigt, wie dies für die Ableitung evolutionärer Verwandtschaften von Organismen genutzt werden kann. Es dauert etwa 90 Minuten und man braucht nur einen Stift und die Tabellen, die von der Science- in-School-Webseite heruntergeladen werden könnenw2.

Haeckels Lebensbaum aus
The Evolution of Man (1879).
Zum Vergrößern auf das Bild
klicken

Public domain image;
Bildquelle: Wikimedia
Commons

Einführung

Denkt darüber nach, wie ihr verschiedene Tiere einteilen würdet. Traditionell verwendete man körperliche Unterschiede zwischen Organismen, um evolutionäre Verwandtschaften abzuleiten, beispielsweise ob ein Organismus ein Rückgrat hat oder Flügel. Das könnte jedoch problematisch werden. Vögel, Fledermäuse und Insekten haben alle ein Rückgrat, aber sind sie eng miteinander verwandt? Wie kann man ermessen, wann die Organismen sich von einem gemeinsamen Vorfahr auseinanderentwickelt haben?

Aus DNA-Sequenzstudien wissen wir, dass Mutationen der DNA zufällig mit geringer Rate geschehen und dass sie von den Eltern an die Nachkommen weitergegeben werden. Angenommen, alle Organismen haben einen gemeinsamen Vorfahren, dann kann man die Unterschiede von homologen Sequenzen nutzen, um den Zeitpunkt der Divergenz der Organismen zu messen. Anders gesagt, je länger es her ist, dass zwei Spezies sich von einem gemeinsamen Vorfahr auseinanderentwickelt haben, desto unterschiedlicher werden ihre DNA-Sequenzen sein.

Homologe Sequenzen sind als die Sequenzen zweier Organismen mit gemeinsamem Ursprung definiert. Es gibt natürlich keinen Beweis für zwei homologe Sequenzen (wir waren ja nicht dabei, als sich die DNA nach und nach verändert hat), aber wenn sie sich ausreichend ähnlich sind, dann nehmen wir oft an, dass sie „homolog“ sind. Um zu erfahren, wie ähnlich sich zwei Sequenzen sind, muss man sie genau abgleichen (aber das ist nicht Teil dieser Aufgabe).

Zu beachten ist, dass verschiedene Bereiche der DNA – codierende und nicht-codierende Bereiche – sich mit unterschiedlicher Geschwindigkeit entwickeln. Allgemein entwickeln sich codierende Regionen langsamer weiter, denn eine Mutation mit einer Veränderung eines Proteins kommt den Organismus teurer zu stehen – er überlebt und pflanzt sich fort mit geringerer Wahrscheinlichkeit. Dieses Thema wird in der Unterrichtsaktivität „Mobile DNA“ diskutiert.

Um das Konzept der Homologie zu veranschaulichen, kann man die Philologie als Beispiel anführen – das Studium der Sprachenentwicklung. Es gibt wirklich viele Parallelen beim Studium der Entwicklung von Sprache und von Organismen.

Der indoeuropäische Sprachenstammbaum. Zu beachten ist, dass obwohl indische, germanische, romanische und viele andere europäische Sprachen zu dieser Familie gehören, finnisch estnisch und ungarisch nicht dazugehören: sie gehören der uralischen Sprachfamilie an. Zum Vergrößern auf das Bild klicken
Datenquelle: www.linguatics.com/indoeuropean_languages.htm

Vergleicht man die Unterschiede zwischen DNA-Fragmenten, dann ist das ein bisschen wie ein Wort derselben Bedeutung in unterschiedlichen Sprachen zu vergleichen, um zu sehen wie eng sie miteinander verwandt sind.

Tabelle 1: Liste des Wortes “Katze” in indogermanischen Sprachen
Datenquelle: http://cats-cat.blogspot.com

Armenisch gatz
Baskisch katu
Niederländisch kat
Englisch cat
Estnisch kass
Finnisch kissa
Isländisch kottur
Italienisch gatto
Norwegisch katt
Polnisch kot
Portugiesisch gato
Russisch kot
Spanisch gato
Schwedisch katt

Man sieht, dass die Worte für “Katze” auf italienisch, spanisch und portugiesisch fast dieselben sidn: gatto, gato und gato. Sowohl auf schwedisch und norwegisch heißt das Wort „katt“, aber man sieht, dass sich finnisch unterscheidet: „kissa“. Obwohl Finnland, wie Schweden und Norwegen, ein nordisches Land ist, ähnelt das finnische Wort für „Katze“ eher dem estnischen Wort, „kass“. Die zwei Sprachen sind tatsächlich enger miteinander verwandt. Auf diese Weise kann man etwas über die Verwandtschaft von Sprachen lernen, indem man studiert, wie sich die Wörter mit der Zeit geändert haben.

Mit freundlicher Genehmigung
von Stephan Franz Xaver Dietl /
pixelio.de

Die Erstellung eines Primatenstammbaumes

Mit dieser Aufgabe erstellen wir einen phylogenetischen Stammbaum mittels fünf homologer Sequenzen von Primaten. Da die Sequenzen ausgedacht sind, können damit keine wirklichen Abschätzungen der genetischen Distanz gemacht werden; um einen sinnvollen Stammbaum aus realen Daten zu erstellen, bräuchte man viel längere Sequenzen. Trotzdem sind die Sequenzen (in Tabelle 2) so ausgewählt, dass sich ein annähernd stimmiges Bild der Primatenverwandschaft ergibt.

Beachte: Alle Tabellen, die die Schüler zur Erledigung dieser Aufgabe benötigen, können von der Science-in-School-Webseiteheruntergeladen werdenw2.

Primat Sequenz
Tabelle 2: Fünf DNA-Sequenzen von Primaten
Neandertaler (n) TGGTCCTGCAGTCCTCTCCTGGCGCCCCGGGCGCGAGCGGTTGTCC
Mensch (h) TGGTCCTGCTGTCCTCTCCTGGCGCCCTGGGCGCGAGCGGATGTCC
Schimpanse (c) TGATCCTGCAGTCCTCTTCTGGCGCCCTGGGCGCGTGCGGTTGTCC
Gorilla (g) TGGACCTGCAGTCATCTTCTGCCCGCCCGAGCGCTTGCCGATGTCC
Orang-Utan (o) ACAACCTGCACTCCTATTCTGCCGAGCCGGGCGCGTGGCAAAGTCC
  1. Zählt die Unterschiede zwischen jedem Sequenzpaar und notiert es in Tabelle 4. Das fällt leicht, wenn die Sequenzen direkt nebeneinander liegen. Beispielsweise differieren die Sequenzen von Neandertaler und Mensch in drei Nukleotiden (Tabelle 3a), wohingegen Schimpansen und Gorillas an 11 Stellen differieren (Tabelle 3b).
Tabelle 3a: Vergleich der Sequenzen von Neandertaler und Mensch
Neandertaler TGGTCCTGCAGTCCTCTCCTGGCGCCCCGGGCGCGAGCGGTTGTCC
Mensch TGGTCCTGCTGTCCTCTCCTGGCGCCCTGGGCGCGAGCGGATGTCC
Tabelle 3b: Vergleich der Sequenzen von Schimpanse und Gorilla
Schimpanse TGATCCTGCAGTCCTCTTCTGGCGCCCTGGGCGCGTGCGGTTGTCC
Gorilla TGGACCTGCAGTCATCTTCTGCCCGCCCGAGCGCTTGCCGATGTCC

Vergleichstabellen für alle Speziespaare und die vervollständigte Tabelle der Speziesunterschiede (Tabelle 4) können von der Science-in-School-Webseiteheruntergeladen werdenw2.

Neandertaler Mensch Schimpanse Gorilla Orang-Utan
Tabelle 4: Sequenzunterschiede zwischen Primaten
Neandertaler 0 3      
Mensch 3 0      
Schimpanse     0 11  
Gorilla     11 0  
Orang-Utan          

Die Zahl der Nukleotiddifferenzen zwischen zwei Sequenzen dividiert durch die Gesamtzahl der Nukleotide jeder Sequenz (hier 46) ergibt den verhältnismäßigen Abstand zweier Sequenzen.

  1. Betrachte die zwei Spezies mit den ähnlichsten Sequenzen: Neandertaler und Mensch. Notiere in Tabelle 5 die Anzahl der Nukleotiddifferenzen (3) und das Verhältnis der Differenzen (3/46 = 0,065).
Unterschiede Verhältnis der Differenzen
Tabelle 5: Evolutionärer Abstand zwischen den Vorfahren der Primaten und den heutigen Primaten
Neandertaler und Mensch 3 3/46 = 0.065
Neandertaler / Mensch und Schimpanse    
Neandertaler / Mensch / Schimpanse und Gorilla    
Neandertaler / Mensch / Schimpanse / Gorilla und Orang-Utan    

Man nimmt an, dass die “mittlere Sequenz” zweier Spezies ihr Vorfahr ist. Mit dieser Übung berechnen wir nicht direkt die mittlere Sequenz beispielsweise von Neandertalern und Menschen, sondern die evolutionäre Distanz zwischen dem gemeinsamen Vorfahr von Neandertaler und Mensch und allen anderen Primaten in der Gruppe.

  1. Berechne den Abstand zwischen der mittleren Sequenz der Neandertaler und Menschen und der anderen Primatenspezies und trage die Daten in Tabelle 6a ein.
    Zwischen Neandertaler und Schimpanse existieren vier Unterschiede und fünf zwischen Mensch und Schimpanse. Daher ist der mittlere Unterschied zwischen Neandertaler / Mensch und Schimpanse 4,5.
    11 Unterschiede gibt es zwischen Neandertaler und Gorilla, und 12 Unterschiede zwischen Mensch und Gorilla. Der mittlere Abstand zwischen Neandertaler / Mensch und Gorilla beträgt daher 11,5.
  Neandertaler / Mensch Schimpanse Gorilla Orang-Utan
Tabelle 6a: Sequenzunterschiede zwischen Vorfahr von Neandertaler / Mensch und anderen Primaten
Neandertaler/ Mensch 0 (4+5)/2 = 4.5 (11+12)/2=11.5  
Schimpanse (4+5)/2 = 4.5 0    
Gorilla (11+12)/2=11.5   0  
Orang-Utan        
  1. Wie zuvor können diese Abstände in verhältnismäßige Abstände umgewandelt werden, indem man durch die Anzahl der Nukleotide jeder Sequenz (46) teilt. Berechne die verhältnismäßigen Abstände zwischen der mittleren Sequenz aus Neandertaler / Menschen und der anderen Primatenspezies. Trage die Zahlen in Tabelle 5 ein.
    Für Schimpansen beträgt der verhältnismäßige Abstand vom Vorfahr Neandertaler / Mensch 4,5/46 = 0,98.

Mit Hilfe von Tabelle 5 kann man mit der Konstruktion des Evolutionsstammbaums beginnen.

  1. Verbinde Neandertaler und Menschen mit einer Linie. Die Astlänge sollte der Zeit entsprechen, die nötig war, um sich vom gemeinsamen Vorfahr zum Menschen und zum Neandertaler auseinanderzuentwickeln.
    Nehmen wir an es dauert 20 Millionen Jahre bis sich ein einzelnes Nukleotid in dieser speziellen DNA-Sequenz ändert. Daher würde es für eine DNA-Sequenz, die sich um 0,065 ändert, 0,065·20 Millionen Jahre = 1,3 Millionen Jahre dauern. Der Ast sollte daher auf der Zeitskala 1,3 Millionen Jahre messen (siehe Abbildung 2).
  2. Zur Berechnung vor wie langer Zeit der Vorfahr der Schimpansen sich vom Menschenvorfahr abspaltete (die Astlänge) addiere die verhältnismäßigen Unterschiede aus Tabelle 5.
    Denke daran, dass der verhältnismäßige Abstand zwischen Vorfahr Neandertaler / Mensch und Schimpanse 0,98 betrug. Daher beläuft sich die Zeit seit der Abspaltung von Schimpansen, Menschen und Neandertaler von ihrem gemeinsamen Vorfahren auf:
    (0.065 + 0.098) * 20 Millionen
    = 0.163 * 20 Millionen
    = 3.3 Millionen Jahre zuvor.
Abbildung 2: Unvollständiger phylogenetischer Stammbaum
Mit freundlicher Genehmigung von Nicola Graf
  1. Berechne weiter. Wiederhole Schritte 3 bis 6 um zu berechnen, vor wie langer Zeit der gemeinsame Vorfahr von Neandertaler / Mensch / Schimpanse sich vom Gorilla und vom Orang-Utan abspaltete. Dann berechne wann der gemeinsame Vorfahr von Neandertaler / Mensch / Schimpanse / Gorilla sich vom Orang-Utan abspaltete. Gib die Egebnisse in Tabelle 5 ein.
    Wenn Du Hilfe brauchst, kannst Du das Schritt-für-Schritt-Verfahren von der Science-in-School-Webseite herunterladen.
  2. Verwende die vervollständigte Tabelle 5 um den phylogenetischen Stammbaum fertigzustellen, wie auf Seite 33 gezeigt.
Abbildung 3: Der fertige phylogenetische Stammbaum
Mit freundlicher Genehmigung von nicola Graf

Fragen

Unten sehen Sie einige Fragen, mit denen Sie das Verständnis Ihrer Schüler von dieser Aufgabe prüfen könnten. Antworten können von der Science-in-School-Webseitew2 heruntergeladen werden.

  1. Vor wie langer Zeit haben sich laut eurem phylogenetischen Stammbaum Gorillas und Menschen auseinanderentwickelt? Wie sieht es bei Oran-Utans und Menschen aus?
  2. Wie kann man herausfinden, ob diese und andere Schätzungen korrekt sind?
  3. Warum können phylogenetische Stammbäume, die aus verschiedenen DNA-Bereichen erstellt werden, unterschiedlich aussehen?
  4. Welche DNA-Bereiche sollte man nehmen, um eng verwandte Organismen zu vergleichen?
  5. Welche Gene sollte man nutzen, um evolutionär weit voneinander liegende Organismen zu vergleichen?
  6. Was ist zu tun, wenn man zwei Sequenzen vergleicht, von denen eine wegen Deletionen Lücken aufweist (oder die andere Sequenz hat Insertionen)?
  7. Gibt es mögliche Gründe, warum der einfache Vergleich der Anzahl von Nukleotidunterschieden bei sehr unterschiedlichen Organismen nicht funktioniert? Bedenke, dass wir eine Zeitspanne von 20 Millionen Jahren für eine Punktmutation annehmen.
  8. Fallen Dir andere Gründe ein, warum diese Methode zur Berechnung evolutionärer Abstände nicht so gut sein könnte? Welche Vereinfachungen haben wir gemacht?
  9. Fallen Dir Gründe ein, warum es beim Studium entfernter verwandten Organismen besser wäre Aminosäuresequenzen statt DNA-Sequenzen zu vergleichen?
  10. In dieser Übung haben wir uns darauf konzentriert, wann die fünf Primatenspezies sich voneinander weg entwickelt haben (die Zeitskala des Stammbaums). Oft jedoch kennen wir nicht die Reihenfolge, in der sich die Spezies trennten (die Form des Baums). Woher wissen wir zum Beispiel, dass Menschen und Schimpansen näher miteinander verwandt sind als Gorillas und Schimpansen? Falls letzteres zutreffen würde, wie anders wären die Sequenzunterschiede (Tabelle 4)?

Danksagung

Diese Aufgaben wurden in einer speziellen Zusammenarbeit zwischen dem „European Learning Laboratory for the Life Sciences“ (ELLS)w1 und den E-STAR-Stipendiaten des European Molecular Biology Laboratory zur Entwicklung von Lehrmaterialien für Schulen erarbeitet. Cleopatra Kozlowski wurde durch ein E-STAR- Stipendium unterstützt, das durch das 6. Rahmenprogramm der Europäischen Kommission, Marie-Curie-Gaststipendium für „Early Stage Research Training” (Forschungsfrühförderung), finanziert wurde, Vertragsnummer.

Download

Download this article as a PDF

Web References

  • w1 – Das “European Learning Laboratory for the Life Sciences” (ELLS) ist eine Ausbildungseinrichtung, die Lehrer der Sekundarstufe im Forschungslabor zu einzigartigen praktischen Erfahrungen mit hochmodernen biologischen Forschungstechniken verhilft. ELLS eröffnet Forschern die Möglichkeit, mit Lehrern zu arbeiten und somit die zunehmend größer werdende Kluft zwischen Forschung und Schulen zu überbrücken. Die in diesem Artikel beschriebene Unterrichtsaktivität war als Lehrmaterial für das „professional development programme“ (Berufliche Weiterbildung) für Lehrer in Europa entworfen worden. Zu weiteren Informationen über ELLS siehe: www.embl.org/ells
  • w2 – Alle für die Ausarbeitung dieser Aufgabe nötigen Tabellen für die Schüler, zusammen mit der Anleitung Schritt-für-Schritt und den Antworten zu den Verständnisfragen, können von der Science-in-School-Webseite heruntergeladen werden, hier.

Resources

Institution

EMBL

Review

Beim Gedanken an Bioinformatik stellen wir uns wahrscheinlich große Computer und Sequenziermaschinen vor, obwohl die Methoden dieses neuen Wissenschaftszweigs mit einfachen Unterrichtsaufgaben vorgestellt werden können, ausgerüstet nur mit Papier und Stift, so wie es Cleopatra Kozlowski in diesem Artikel tut.

Die Autorin stellt uns vor die Aufgabe, einen Familienstammbaum des Menschen und anderer Primaten auf der Basis von genetischen Unterschieden zwischen kurzen (ausgedachten) DNA-Sequenzen zu erstellen. Dieser Vorschlag einer Unterichtsgestaltung kann in Schulen der Sekundarstufe gewinnbringend (und vergnüglich) ausgeschöpft werden, um einige knifflige Themen aus der Biologie, wie molekulare Uhren zum Studium der Evolution, anzugehen.

Der Beitrag richtet sich an Lehrer in den Naturwissenschaften, die am Ende des Textes nützliche Verständnisfragen finden werden; auch Schüler können die Fragen nutzen, um ihr Verständnis des Themas zu vertiefen. Die angeführten Internetreferenzen führen zu weiteren Informationen und Materialien


Giulia Realdon, Italien




License

CC-BY-NC-SA