Bioinformatika tollal és papírral: készítsünk filogenetikai fát Teach article

Fordította: Kapitány János Sándor. A bioinformatikához általában egy erős számítógépre van szükségünk. Azonban Cleopatra Kozlowski segítségével csupán egy tollal és papírral felfegyverkezve is megvizsgálhatjuk főemlős származásunkat.

A képeket hometowncd /
iStockphoto szíves
hozzájárulásával közöljük

A legújabb technológiáknak köszönhetően, viszonylag könnyen és gyorsan meghatározhatjuk egy DNS vagy fehérje szekvenciáját. Ezek a szekvenciák önmagukban természetesen elég keveset árulnak el számunkra: például GAATCCA. Tudnunk kell értelmezni ezeket a szekvenciákat. Melyik fehérjét kódolja ez a DNS szekvencia; egyáltalán fehérjét kódol-e az adott szekvencia? Milyen hatással van a DNS szekvencia kis változtatása a kódolt fehérje szerkezetére? Milyen funkciója less a fehérjének a sejtben? És, persze mit tud mesélni számunkra a DNS szekvenciánk az evolúciós történetünkről?

Ezekkel és más fontos biológiai kérdésekkel foglalkozik a bioinformatika: különösen, a DNS vagy fehérjék szekvenciájának összehasonlításával – például újonnan felfedezett szekvenciák összehasonlítása olyan, korábban már megismert szekvenciákkal, amelyekről már több információval is rendelkezünk (talán van hasonló funkciójuk?) vagy összehasonlíthatjuk a különböző fajokban található hasonló szekvenciákat.

A bioinformatika, normális esetben egy erős számítógép segítségével működik. Az azonban túlságosan könnyű lenne, ha hagynánk, hogy egy számítógép végezze el az összes munkát anélkül, hogy megértenénk a lefektetett alapelveket. Ebből kifolyólag ezt a tevékenységet papíron végezzük el, hogy a diákok megérthessék, hogyan működik a bioinformatikai analízis.

Ez a cikk egy négyféle tevékenységet tartalmazó csoport egyike. A két bevezető tevékenység (‘Gén keresés’ és ‘Mutációk’) és a befejező tevékenység (‘Mobil DNS’) letölthető az Az Európai Tanulási Laboratórium a Természettudományok számára (European Learning Laboratory for the Life Sciences = ELLS)w1. A tanulók számára szükséges táblázatok, együtt az eljárás lépésről-lépésre leírásával és a megértést segítő kérdésekre adott válaszokkal, letölthetők a Science in School weboldalárólw2.

Filogenetikai fa készítése

A mutációk felhalmozódása okozza a DNS szekvencia generációk alatt bekövetkező változását. A következő tevékenység azt mutatja meg, hogyan lehet ezt a szervezetek közötti evolúciós kapcsolatok levezetésére használni. Körülbelül 90 percet vesz igénybe és nem igényel semmi mást csak egy tollat és a táblázatokat, amelyek letölthetők a Science in School weboldalárólw2.

Haeckel életfája az ember
evolúciója c. művéből (The
Evolution of Man
(1879)). A
nagyobb méretű változatért
kattintson a képre

Public domain image; image
source: Wikimedia Commons

Bevezetés

Gondoljatok bele, hogyan kellene osztályozni a különböző állatokat. Hagyományosan, a szervezetek közötti fizikai különbségeket (morfológiai jegyeket) használták az evolúciós kapcsolataik levezetése céljából, például hogy egy szervezetnek van hátgerince vagy vannak szárnyai. Ez problémákat okozhat. Például a madarak, denevérek és rovarok mindegyike rendelkezik szárnyakkal, de valóban közeli rokonok? Hogyan mérnéd, hogy a jelenlegi szervezetek, hogyan tértek el a korábbi közös őstől?

A DNS szekvenálási tanulmányainkból tudjuk, hogy a DNS mutációk véletlenszerűen fordulnak elő, nagyon kis arányban átadódnak a szülőktől az utódnak. Így ha feltételezzük, hogy minden szervezetnek van egy közös őse, akkor arra használhatjuk a homológ szekvenciák különbségeit, hogy megmérjük, milyen hosszúságúak lettek, amióta a szervezetek eltértek egymástól. Más szavakkal, ha két faj régebben jött létre egy közös ősből, akkor a DNS szekvenciájuk jobban eltér egymástól.

A homológ szekvenciákat úgy határozhatjuk meg, mint két azonos eredetű szervezetben található szekvenciák. Valójában nincs bizonyítékunk arra, hogy bármely két szekvencia homológ lenne (mivel nem voltunk ott, hogy megfigyeljük a DNS-t, ahogy az idő során megváltozott) de amelyek kellően hasonlóak, azokról gyakran feltételezik, hogy homológok. Két szekvencia hasonlóságát akkor tudjuk megvizsgálni, ha azokat helyesen rendezzük el egymáshoz képest (de ez nem része ennek a tevékenységnek).

A különböző DNS régiók – kódoló (exon) és nem-kódoló (intron) szakaszok – eltérő sebességgel fejlődnek. Általában a kódoló régiók sokkal lassabban változnak, mert egy mutáció, ami a fehérjében változást okoz, általában sokkal inkább a szervezetben vált ki hatást – kevésbé él túl marad fenn az utódban. Erről a ‘Mobil DNS’ tevékenységben lehet beszélgetni.

A homológia fogalmának illusztrálásához, felhasználhatjuk példának a filológiát – a nyelvek evolúciójának tanulmányozását. Tény, hogy sok párhuzamot találhatunk a nyelvek és a szervezetek evolúciójának tanulmányázásában.

1. ábra: Az Indo-európai nyelvek fája. Megjegyzés, habár az indiai, a germán és római és más egyéb európai nyelvek ehhez a nyelvcsaládhoz tartoznak, a Finn, az Észt és a Magyar nem: ezek az Uráli nyelvcsaládhoz tartoznak. A nagyobb méretű változatért kattintson a képre
Adatforrás: www.linguatics.com/indoeuropean_languages.htm

A DNS szekvenciák töredékei közötti különbségek értelmezése, egy kicsit olyan mintha összehasonlítanánk egy adott szónak különböző nyelvekben előforduló alakjait, hogy lássuk milyen közeli a kapcsolatuk egymáshoz.

1.táblázat: A ‘macska’ szó Indo-európai nyelvekben előforduló alakjai
Adatforrás: http://cats-cat.blogspot.com

Örmény gatz
Baszk katu
Holland kat
Angol cat
Észt kass
Finn kissa
Izlandi kottur
Olasz gatto
Norvég katt
Lengyel kot
Portugál gato
Orosz kot
Spanyol gato
Svéd katt

Láthatjátok, hogy a ‘macska’ szó az olaszban, spanyolban és portugálban majdnem ugyanaz: gatto, gato és gato. Mind a Svéd és Norvég nyelvben ‘katt’, de a Finn nyelvben eltérő: ‘kissa’. Habár Svédország, Norvégia és Finnország mind Északi ország, a Finn szó a ‘macska’ esetében inkább az Észt ‘kass’ szóhoz hasonlít. Tény, hogy ez a két nyelv sokkal szorosabb kapcsolatban van egymással. Szóval lehet egy kicsit tanulnia nyelvek kapcsolatának tanulmányozásából arról, hogyan változtak a szavak az idők során.

A képeket Stephan Franz Xaver
Dietl / pixelio.de szíves
hozzájárulásával közöljük

A főemlősök filogenetikai fájának elkészítése

Ezen tevékenység során, egy filogenetikai fát fogunk készíteni öt főemlős homológ DNS szekvenciájának segítségével. Mivel ezek a szekvenciák kitaláltak, ezért nem tudunk következtetni valódi becsült genetikai távolságokra; egy értelmes filogenetikai fa létrehozásához valós adatokból, és sokkal hosszabb szekvenciákból kellene építkeznünk. Mindazonáltal ezeket a fiktív szekvenciákat (a 2. táblázatban) úgy választottuk meg, hogy ésszerűen pontos képet adjanak a főemlősök kapcsolatáról.

Megjegyzés: A tanulók számára a tevékenység teljesítéséhez szükséges táblázatok letölthetők a Science in School weboldalárólw2.

Főemlős Szekvencia

2.táblázat: Öt DNS szekvencia a főemlősöktől

Neander-völgyi (n) TGGTCCTGCAGTCCTCTCCTGGCGCCCCGGGCGCGAGCGGTTGTCC
Emberi (h) TGGTCCTGCTGTCCTCTCCTGGCGCCCTGGGCGCGAGCGGATGTCC
Csimpánz (c) TGATCCTGCAGTCCTCTTCTGGCGCCCTGGGCGCGTGCGGTTGTCC
Gorilla (g) TGGACCTGCAGTCATCTTCTGCCCGCCCGAGCGCTTGCCGATGTCC
Orángután (o) ACAACCTGCACTCCTATTCTGCCGAGCCGGGCGCGTGGCAAAGTCC
  1. Számoljuk meg az egyes szekvencia párok közötti különbségeket és rögzítsük a 4. táblázatban. Ezt nem nehéz megtenni, ha összehasonlítjuk ezeket egymással. Például a Neander-völgyi és az emberi szekvencia 3 nukleotiddal tért el egymástól (3.a táblázat), de a csimpánz és a gorilla szekvenciája 11 ponton tér el egymástól (3.b táblázat).
3.a táblázat: A Neander-völgyi és az emberi szekvencia összehasonlítása
Neander-völgyi TGGTCCTGCAGTCCTCTCCTGGCGCCCCGGGCGCGAGCGGTTGTCC
Emberi TGGTCCTGCTGTCCTCTCCTGGCGCCCTGGGCGCGAGCGGATGTCC
3.b táblázat: A csimpánz és a gorilla szekvencia összehasonlítása
Csimpánz TGATCCTGCAGTCCTCTTCTGGCGCCCTGGGCGCGTGCGGTTGTCC
Gorilla TGGACCTGCAGTCATCTTCTGCCCGCCCGAGCGCTTGCCGATGTCC

Az összehasonlító táblázatok minden szekvencia párhoz és a főemlősök szekvenciáinak különbségeit tartalmazó befejező táblázat (4. táblázat) letölthető a Science in School weboldalárólw2.

Neander-völgyi Emberi Csimpánz Gorilla Orángután
4.táblázat: a főemlősök szekvenciái közötti különbségek
Neander-völgyi 0 3      
Emberi 3 0      
Csimpánz     0 11  
Gorilla     11 0  
Orángután          

A nukleotid eltérések száma két szekvenciában osztva a nukleotidok számával szekvenciánként (ebben az esetben 46) megadja az arányos távolságot a két szekvencia között.

  1. Tekintsük meg a két egymáshoz leginkább hasonló szekvenciájú faj: a Neander-völgyi és ember esetében. Az 5. táblázatban rögzítsük a nukleotid eltérések számát (3) és az arányos távolságot (3/46 = 0.0065).
Különbségek Arányos különbség
5.táblázat:Evolúciós távolságok a főemlős ősök és a főemlősök között
Neander-völgyi és emberi 3 3/46 = 0.065
Neander-völgyi / emberi és csimpánz    
Neander-völgyi / emberi / csimpánz és gorilla    
Neander-völgyi / emberi / csimpánz / gorilla és orang-utan    

Az ‘átlagos szekvenciája’ két fajnak feltételezhetően a közös ősüknek köszönhető. Ebben a feladatban, mi közvetlenül nem számoljuk ki az átlagos szekvenciákat, például a Neandervölgyiek és az emberek között, hanem az evolúciós távolságokat számoljuk ki a Neandervölgyi /emberi ősök és a csoportban szereplő főemlősök között.

  1. Számoljuk ki a távolságot a Neandervölgyi és emberi közös szekvenciából, és más főemlős fajokéból, majd írjuk be az eredmény a 6.a táblázatba.
    A Neandervölgyi és a csimpánz szekvenciája között 4 eltérés van, míg az emberi és a csimpánz szekvenciák között 5 eltérés tapasztalható. Így az átlagos távolság a Neandervölgyi / emberi ős és a csimpánz között 4.5.
    A Neandervölgyi és a gorilla szekvenciája között 11 eltérés van, míg az emberi és a gorilla szekvenciák között 12 eltérés tapasztalható. Így a Neandervölgyi/emberi ős és a gorilla közötti átlagos távolság 11.5.
  Neander-völgyi és emberi Csimpánz Gorilla Orángután
6.a táblázat: A Neander-völgyi / ember ős és más főemlősök szekvencia különbségei
Neander-völgyi és emberi 0 (4+5)/2 = 4.5 (11+12)/2=11.5  
Csimpánz (4+5)/2 = 4.5 0    
Gorilla (11+12)/2=11.5   0  
Orángután        
  1. Mielőtt ezeket a távolságokat átválhatnánk arányos különbségekké el kell osztanunk ezeket a szekvencia nukleotidjainak számával (46). Számoljuk ki az arányos távolságokat a Neandervölgyi/emberi átlagos szekvencia és más főemlős fajok szekvenciái között. Írjuk be az eredményeket az 5. táblázatba.
    Csimpánzoknál az arányos távolság a Neandervölgyi/emberi ősnek a szekvenciájától 4.5/46 = 0.98.

Az 5. táblázat használatával megkezdhetjük az evolúciós fánk építését.

  1. Kapcsoljuk össze a Neandervölgyieket és az embereket egy vonallal. Az ág hosszának meg kell egyeznie azzal, hogy mennyi idő telt el az emberek és a Neandervölgyiek közös ősből történő szétválásától.
    Tételezzük fel, hogy 20 millió évre van szükség arra, hogy a DNS szekvenciában egy egyszerű nukleotid megváltozzon. Így a DNS szekvencia 0.065-ös szorzóval (lásd fent, arányos különbség) történő megváltozásához, eszerint 0.065*20 millió = 1.3 millió évre lenne szükség. Ki kell mérnünk, tehát hogy ez az ág, 1.3 millió év hosszúságú legyen az időbeosztásunkon (lásd 2. ábra).
  2. Ahhoz, hogy kiszámoljuk, hogy mennyi idő telt el azóta, hogy a csimpánzok őse szétvált az emberek ősétől (ág hossza), adjuk hozzá az arányos különbségeket, az 5. táblázatból.
    Emlékeztetőül, az arányos távolság a Neandervölgyi/emberi ős és a csimpánzok között 0.98 volt. Így a csimpánzok, emberek és neandervölgyiek szétválása óta eltelt idő:
    (0.065 + 0.098) * 20 millió
    = 0.163 * 20 millió
    = 3.3 millió év.
2. ábra: Befejezetlen filogenetikai fa
A képeket Nicola Graf szíves hozzájárulásával közöljük
  1. Folytassuk a számításokat. Ismételjük meg a 3. és 6. lépést, hogy kiszámoljuk, hogy mennyi idő telt el a Neandervölgyi/emberi/csimpánz ős gorilláktól történő elválásától és az orángutánoktól való elválástól. Aztán számoljuk ki, hogy mennyi idő telt el a Neandervölgyi / emberi /csimpánz/ gorilla ős és az orángután szétválásától. Írjuk be az eredményeket az 5. táblázatba.
    Ha segítségre van szükségetek, akkor letölthetitek a procedúra lépésről-lépésre haladó leírását a Science in School weboldaláról.
  2. Használjátok a kitöltött 5. táblázatot a filogenetikai fa befejezéséhez, úgy ahogy ez a 33. oldalon látható.
3.ábra: Komplett filogenetikai fa
A képeket Nicola Graf szíves hozzájárulásával közöljük

Kérdések

Alább található néhány kérdés, aminek segítségével letesztelhetjük, hogy tanulóink megértették-e a tevékenységet. A válaszok letölthetők a Science in School weboldalárólw2.

  1. Hány év telt el a filogenetikai fádban, mióta a gorilla és az emberek szétváltak közös ősüktől? Mi a helyzet az orángutánokkal és az emberekkel?
  2. Vajon a becsléseink helyesek a filogenetikai fában?
  3. Miért lehet filogenetika fákat készíteni az alapján, hogy a DNS különböző régiói eltérőek?
  4. A DNS mely régiói használhatók arra, hogy megállapítsuk a különböző élőlények közeli rokonságát?
  5. Mely géneket kellene összehasonlítani, ha evolúciós távolságokat szeretnénk az élőlények között meghatározni?
  6. Mi a teendőnk akkor, ha két szekvencia összehasonlításakor azt vesszük észre, hogy az egyik üres helyeket tartalmaz deléciók miatt (vagy inszerció miatt a másik szekvenciában)?
  7. Gondoljuk végig annak a lehetséges okait, hogy miért nem használhatjuk a nukleotid különbségek számának egyszerű összehasonlítását olyan esetben, ha nagyon eltérő élőlényeket kell összehasonlítanunk?Emlékeztetőül: a szekvencia mutációja során minden nukleotid változáshoz körülbelül 20 millió évre van szükség.
  8. Milyen más okai vannak annak, hogy nem használható ez a módszer az evolúciós távolságok számítására? Milyen egyszerűsítéseket tettünk?
  9. Milyen okai vannak annak, hogy a nagyobb távolságokra lévő élőlények tanulmányozásához jobb, ha az aminosav szekvenciákat hasonlítjuk össze és nem a DNS szekvenciákat?
  10. Ennek a feladatnak az elkészítése során mi az öt főemlős faj elkülönülésére koncentráltunk (a fa beosztása). Gyakran, nem ismerjük a sorrendjét annak, hogy melyik élőlény melyiktől vált szét (a fa alakja). Hogyan tudjuk azt megmondani, hogy emberek és a csimpánzok közelebbi rokonok, mint a gorillák és a csimpánzok? Ha ez utóbbi állításunk igaz, hogyan térnek el a szekvenciák egymástól? (4. táblázat)

Köszönetnyilvánítás

Ez a tevékenység az Európai Élettudományi Oktató Laboratórium (European Learning Laboratory for the Life Sciences = ELLS)w1 és az Európai Molekuláris Biológia Laboratórium (European Molecular Biology Laboratory) E-STAR munkatársai közötti különleges kollaborációval készült, tanítási anyagként iskolák számára. Cleopatra Kozlowski egy E-STAR ösztöndíjas volt, ami az Európai Bizottság 6. keretprogramjának Marie Curie ösztöndíja Korai stádiumú kutatási tréningeknek, a MEST-CT-2004-504640 szerződés szám alatt.

Download

Download this article as a PDF

Web References

  • w1 – Európai Élettudományi Oktató Laboratórium (The European Learning Laboratory for the Life Sciences (ELLS)) egy oktatási létesítmény, mely beviszi a középiskolai tanárokat a kutató laboratóriumokba egy egyedi gyakorlati találkozásra a csúcs molekuláris biológiai technikákkal. Az ELLS megadja annak a lehetőségét is, hogy a kutatók együtt dolgozzanak a tanárokkal, segítve egy híd kialakítását a tátongó szakadék felett, ami a kutatás és az iskolák között alakult ki. A cikkben leírt tevékenységet arra tervezték, hogy oktatási forrás legyen az ELLS európai tanárok számára készülő professzionális fejlesztési programjában. További információkért az ELLSről, lásd: www.embl.org/ells
  • w2 – Az összes, diákok számára szükséges táblázat letölthető ennek a tevékenységnek az elvégzéséhez, együtt a lépésről-lépésre leírással és a feltett kérdésekre adható válaszokkal, a Science in School weboldaláról, itt.

Resources

Institution

EMBL

Review

Amikor bioinformatikára gondolunk általában nagy teljesítményű számítógépekkel és szekvenáló gépekkel képzeljük el, de ennek az új tudománynak az eljárásai bemutathatók egyszerű osztálytermi gyakorlatokkal is, amihez csak ceruza és papír szükséges, ahogy Cleopatra Kozlowski is csinálta ebben a cikkben.

A szerző kihívásként azt tűzi ki számunkra, hogy készítsünk egy olyan filogenetikai fát, amelyben az emberek és más főemlősök közötti távolságok mutatjuk be, amihez genetikai különbségeket használunk, (hamis) rövid DNS szekvenciákat. A javasolt tevékenység hasznosan kiaknázható (és élvezetes) a középiskolákban, néhány trükkös biológia témánál, például az evolúció tanításakor a molekuláris órák témánál.

A cikk célja a tudományos tantárgyakat oktató tanárok segítése, akik a tanítás során használhatják a szövegértési gyakorlatot a szöveg végén; a diákok pedig arra használhatják a kérdést, hogy elmélyítsék ismereteiket a témában. Az idézett internetes hivatkozásokon további információkat és forrásokat találhatunk.


Giulia Realdon, Olaszország




License

CC-BY-NC-SA