Kalem ve kağıtla biyoinformatik: filogenetik ağaç oluşturma Teach article

Tercüme eden: Yasemin Gökçek ve Hikmet Geçkil (İnönü Üniversitesi, Moleküler Biyoloji ve Genetik Bölümü). Biyoinformatik genellikle güçlü bilgisayarlarla yapılır. Ancak burada Cleopatra Kozlowski’nin yardımıyla kalem ve kağıttan başka birşey kullanmadan primat…

Resim: hometowncd /
iStockphoto izniyle

Son dönemlerde meydana gelen teknolojik gelişmelerin bir sonucu olarak bir DNA ya da protein dizisini belirlemek oldukça kolay ve hızlı gerçekleşebilmektedir. Elbette bu diziler kendi başlarına bizlere çok az şey anlatır : örneğin GAATCCA. Bu dizilerin ne anlama geldiğini bilmemiz gerekir. Hangi proteinler bu DNA dizisi ile kodlanmıştır? veya aslında dizi bir proteini gerçekten kodlamış mıdır? DNA dizisinde meydana gelecek küçük bir değişikliğin kodlanmış protein üzerinde nasıl bir etkisi olur? Bu proteinin hücrede ne gibi bir işlevi vardır? Ve elbette, DNA dizilerimiz bize evrimleşme tarihimiz hakkında neler anlatır?

Bunlar ve diğer benzeri önemli biyolojik sorulara biyoenformatik aracılığıyla yanıtlar bulabiliriz: örneğin; dizisi ve işlevini iyi bildiğimiz DNA ya da proteinleri, yeni keşfedilen DNA ve protein dizileri ile karşılaştırarak bunlar hakkında bilgi sahibi olabiliriz.

Biyoinformatik normalde güçlü bir bilgisayar yardımı ile yapılır. Ancak, bu işin temelini anlamadan, bilgisayarın bütün işleri yaptığını düşünmek basit bir yaklaşım olur. Bu nedenle, öğrencilerin biyoinformatik analizlerin nasıl işlediğini anlamasını sağlamak için bu etkinlikler kağıt üzerine tasarlanarak yapılır.

Bu makale dört etkinlik grubundan birini içerir. İki giriş etkinliği (“Gen bulma” ve “Mutasyonlar”) ve sonuç etkinliği (“mobil DNA”) Avrupa Yaşam Bilimleri Öğrenme Laboratuvarının (ELLS)w1 web sitesinden indirilebilir. Bu etkinlikleri tamamlamak için kapsamlı soruların cevapları ve süreçleri ve öğrencilerin ihtiyaç duyduğu bütün çizelgeler Science in School ‘un web sayfasından indirilebilirw2.

Bir filogenetik ağaç oluşturma

Mutasyonların birikimi DNA dizilerinin nesiller boyunca dğişmesine neden olur. Aşağıda verilen etkinlik, bu durumdan faydalanarak organizmalar arasındaki evrimsel ilişkilerin nasıl saptandığını açıklamaktadır. Bu yalnızca 90 dakika alır ve bir kalemle Science in School sitesinden indirilebilecek tablolardan başka hiçbir şey gerektirmezw2.

Haeckel’in yaşam ağacı’ndan
The Evolution of Man (1879).
Büyütmek için resmin üzerini
tıklayınız

Kullanımı serbest resim; resim
kaynağı: Wikimedia Commons

Giriş

Çeşitli hayvanları nasıl sınıflandırdığınızı bir düşünün. Geleneksel olarak organizmalar arasındaki fiziksel farklar birbirlerinin arasındaki evrim ilişkisini çözmlemek için kullanılırdı. Örneğin; bir organizmanın kemiğinin ya da kanadının olup olmaması gibi. Ancak, bu sorunlara yol açabilir. Örneğin; kuşlar, yarasalar ve böceklerin kanatları vardır ama bu üçü bir birleriyle yakından ilişkili midir? Organizmaların ortak bir atadan ne zaman ayrılıp değiştiklerini nasıl ölçersiniz?

DNA dizisi çalışmalarından, DNA’daki mutasyonların rastgele bir şekilde ve çok yavaş bir oranda nesilden nesile geçerek gerçekleştiğini biliyoruz. Bu demektir ki, tüm organizmaların ortak bir atadan geldiğini düşünecek olursanız, bu organizmaların son şeklini aldığından beri ne kadar bir zaman geçtiğini ölçebilmek için homolog dizilerdeki farklılıkları kullanabilirsiniz. Başka bir ifadeyle iki türün ortak bir atadan oluştuğu zaman ne kadar geçmişte kaldıysa, onların DNA dizileri o kadar birbirinden farklı olur.

Homologous dizler, ortak bir kökene sahip olan iki organizmadaki benzer diziler olarak tanımlanır. Aslında herhangi iki dizinin homolog olduğuna ilişkin kanıtlarımız yoktur (DNA değişim sürecini izlemek için biz orada değildik!). Ama bu diziler yeterince benzer iseler, çoğu kez onların “homolog” olduğunu varsayarız. İki dizinin ne kadar benzer olduğunu bilmek için, onları doğru bir şekilde sıralama gereksinimi duyarsınız (ama bu, bu etkinliğin kapsamı içinde değildir).

DNA’nın farklı alanlarına dikkat ediniz- kodlanan ve kodlanmayan alanlar- farklı hızlarda geliştiriniz. Genel olarak, kodlanan alanlar daha yavaş bir şekilde gelişir, çünkü, bir proteinde değişikliğe neden olan bir mutasyon organizma için genellikle daha değerlidir- bu organizmanın hayatta kalması ve ürün vermesi daha az olasıdır. Bu “Mobil DNA” etkinliğinde tartışılmıştır.

Homoloji kavramını örneklerle açıklamak için, filoloji (dillerin evrimleşmesinin çalışılması) örneğini kullanabilirsiniz. Aslında, dil ve organizmaların evrimini araştırmak için kullanılan yöntemler arasında pek çok benzerlik vardır.

Hint-Avrupa dil ağacı. Hintçe, Germanik dillerc, Romence ve diğer birçok Avrupa dilinin bu aileye ait olduğu görülse de, Fince, Estonya dili ve Macarca bu aileye ait değildir: bu diller Ural dil grubuna bağlıdır. Büyütmek için resmin üzerini tıklayınız
Veri kaynağı: www.linguatics.com/indoeuropean_languages.htm

DNA parçaları arasındaki dizi benzerliklerini araştırmak, iki dilde aynı şeyin hangi sözcüklerle anlatıldığını araştırmaya benzer.

Tablo 1: Hint-Avrupa Dillerinde “kedi”sözcüğü
Veri kaynağı: http://cats-cat.blogspot.com

Ermenice gatz
Bask dilinde katu
Hollanda dilinde kat
İngilizce cat
Estonya dilinde kass
Fince kissa
İzlanda dilinde kottur
İtalyanca gatto
Norveççe katt
Polonya dilinde kot
Portekizce gato
Rusça kot
İsponyolca gato
Isveççe katt

“Kedi” için İtalyanca, İspanyolca ve Portekizce dilinde kelimelerin neredeyse aynı olduğunu görebilirsiniz: gatto, gato and gato. Hem İsveççede hem de Norveççede, kelime “katt” tır, Fincede farklı olduğunu görebilirsiniz: ‘kissa’. İsveç ve Norveç gibi Finlandiya da bir İskandinav ülkesi olmasına rağmen ‘kedi’ için Fince kelime Estony dilindeki ‘kass’kelimesine daha benzerdir. Aslında bu iki dil birbiri ile daha yakından ilişkilidir. Bu yüzden kelimelerin nasıl zamanla değiştiğini araştırarak diller arasındaki ilişkiyi bir nebze öğrenebilirsiniz.

Resim: Stephan Franz Xaver
Dietl / pixelio.de izniyle

Primatların filogenetik ağacının oluşturulması

Bu etkinlikte, primatlardan beş homolog DNA dizisi kullanarak filogenetik ağaç oluşturacağız. Diziler tamamen bizim tarafımızdan uydurulduğundan, gerçek veriler için daha uzun diziler gerektiren ve genetik mesafenin hesaplanmasını sağlayan filogenetik ağaç yaratamayız. Ama yine de, primat ilişkilerini mantıklı bir şekilde tam doğru olarak anlamak için bu kurgusal diziler (Tablo 2) seçilmiştir.

Not: Bu etkinliği tamamlamak için öğrencilerin gereksinim duyduğu bütün çizelgeler Science in School’un web sayfasından indirilebilirw2.

Primat Diziler

Tablo 2: Primatlardan 5 adet DNA dizisi

Neanderthal (n) TGGTCCTGCAGTCCTCTCCTGGCGCCCCGGGCGCGAGCGGTTGTCC
İnsan (h) TGGTCCTGCTGTCCTCTCCTGGCGCCCTGGGCGCGAGCGGATGTCC
Şempanze (c) TGATCCTGCAGTCCTCTTCTGGCGCCCTGGGCGCGTGCGGTTGTCC
Goril (g) TGGACCTGCAGTCATCTTCTGCCCGCCCGAGCGCTTGCCGATGTCC
Orangutan (o) ACAACCTGCACTCCTATTCTGCCGAGCCGGGCGCGTGGCAAAGTCC
  1. İki dizi arasındaki farkları sayınız ve Tablo 4’e kaydediniz. Her diziyi yan yana kıyaslarsanız bunu yapmak daha kolaydır. Örneğin, Neanderthaller ve insanlar 3 nükleotid dizisinde farklılık göstermektedir (Tablo 3a), oysa şempanzeler ve goriller 11 noktada farklılık göstermektedir (Tablo 3b).

Tablo 3a: Neanderthal ve insan dizilerinin karşılaştırılması

Neanderthal TGGTCCTGCAGTCCTCTCCTGGCGCCCCGGGCGCGAGCGGTTGTCC
İnsan TGGTCCTGCTGTCCTCTCCTGGCGCCCTGGGCGCGAGCGGATGTCC

Tablo 3b: Şempaze ve goril dizilerinin karşılaştırılması

Şempanze TGATCCTGCAGTCCTCTTCTGGCGCCCTGGGCGCGTGCGGTTGTCC
Goril TGGACCTGCAGTCATCTTCTGCCCGCCCGAGCGCTTGCCGATGTCC

Bütün canlı türleri için bu şekilde karşılaştırma ve dizi farklılıklarını (Tablo 4) Science in School’un web sayfasından indirebilirsenizw2.

Neanderthal İnsan Şempanze Goril Orangutan

Tablo 4: Primat dizileri arasındaki farklar

Neanderthal 0 3      
İnsan 3 0      
Şempanze     0 11  
Goril     11 0  
Orangutan          

İki dizi arasındaki farklı nükleotidlerin toplam sayısı ile her dizideki toplam nükleotid sayısına bölümü (bu durumda, 46) oransal uzaklığı verir.

  1. Dizileri en çok benzerlik gösteren iki tütü dikkate alınız: Neanderthal ve insan. Tablo 5’te, nükleotid farklılık sayısını (3) ve oransal farklılıkları kaydediniz (3/46 = 0.065).
Farklılıklar Oransal farklılık

Tablo 5: Primatların primat ataları ile evrimsel uzaklığı

Neanderthal ve insan 3 3/46 = 0.065
Neanderthal/insan ve şempanze    
Neanderthal/insan/şempanze ve goril    
Neanderthal/insan/şempanze/goril ve orangutan    

İki türün “ortak benzer disizi” onların ortak ataları olduğu varsayılır. Bu egzersizde, Neanderthaller ve insanlar arasındaki ortalama diziyi doğrudan hesaplamıyoruz, ancak Neanderthal/insan atası ve gruptaki diğer primatlar arasındaki evrim uzaklığını buluyoruz.

  1. Neanderthallerin ve insanların ve diğer primat türlerinin ortalama dizilimi arasındaki uzaklığı hesaplayınız ve verileri Tablo 6a’ya giriniz.
    Neanderthaller ile Şempanzeler arasında dört fark; insan ve şempanzeler arasında ise beş fark vardır. Böylece Neanderthal/insan ve şempanzeler arasında ortalama uzaklık 4.5’tir.
    Neanderthal ile goril arasında 11 farklılık ve insan ile goril arasında ise 12 farklılık vardır. Böylece Neanderthal/insan ve şempanzeler arasında ortalama uzaklık 11.5’tir.
  Neanderthal/ İnsan Şempanze Goril Orangutan
Table 6a: Neanderthal / insan atası ve diğer primatlar arasındaki dizi farklılıkları
Neanderthal/ İnsan 0 (4+5)/2 = 4.5 (11+12)/2=11.5  
Şempanze (4+5)/2 = 4.5 0    
Goril (11+12)/2=11.5   0  
Orangutan        
  1. Önceki gibi, bu farklılıklar her bir dizideki nükleotidlerin sayısı ile bölünerek oransal farklılıklara dönüştürülebilir (46). Neanderthaller/insanlar ve diğer primat türlerinin ortalama dizilimi arasındaki oransal farklılıkları hesaplayınız. Hesaplamalarınızı Tablo 5’te yerleştiriniz.
    Şempazeler için, Neanderthal/insan atadan orantılı mesafe 4.5/46 = 0.98.

Tablo 5’i kullanarak, evrim ağacını oluşturmaya başlayabilirsiniz.

  1. Neanderthaller ile insanları bir çizgi ile birleştiriniz. Dal uzunluğu onların ortak atalarından ne kadar zman önce ayrıldıklarını göstermektedir.

    Bu özel örneğimizde, DNA dizisindeki bir nükleotidin farklı olmasının 20 milyon yıl alacağını varsayalım. Böylece DNA dizisinin 0.065’lik değişimi, 0.065×20 milyon=1.3 milyon yıl alacaktır. Dal, bu nedenle zaman ölçeğinde 1.3 milyon yıl olarak ölçülmelidir (bkz. Şekil 2).

  2. Şempanzelerin atalarının insanların atalarından ne kadar zaman önce ayrıldığını ölçmek için (dal uzunluğu), Tablo 5’teki oransal farklılıkların toplamını bulunuz.
    Neanderthal/insan atası ve şempanzeler arasındaki oransal uzaklığın 0.98 olduğunu hatırlayınız. Böylece şempanzeler, insanlar ve Neanderthaller ortak bir atadan ayrılma zamanı:
    (0.065 + 0.098) * 20 milyon
    = 0.163 * 20 milyon
    = 3.3 milyon yıl önce.
Şekil 2: Tamamlanmamış filogenetik ağaç
Resim: Nicola Graf’ın izniyle
  1. Hesaplamalara devam ediniz. 3’ten 6’ya kadar olan basamakları tekrarlayınız ve Neanderthal/insan/şempanze atalarının ne kadar zaman önce goril ve orangutandan ayrıldığını hesaplayınız. Daha sonra Neanderthal/insan /şempanze/goril atasının orangutandan ne kadar zaman önce ayrıldığını hesaplayınız. Sonuçları Tablo 5’e giriniz.
    Yardıma ihtiyaç duyarsanız, Science in School ‘un web sayfasından prosedürü aşama aşama indirebilrsiniz.
  2. Filogenetik ağacı bitirmek için aşağıda gösterildiği gibi tamamlanmış Tablo 5’i kullanınız.
Şekil 3: Tamamlanmış filogenetik ağaç
Resim: Nicola Graf’ın izniyle

Sorular

Öğrencilerinizin etkinliği anlayıp anlamadıklarını test etmek için aşağıdaki soruları kullanabilirsiniz. Cevaplar Science in School’un web sitesinden indirilebilirw2.

  1. Filogenetik ağacınızda, goriller ve insanlar kaç yıl önce ortak bir atadan ayrılmıştır?
  2. Ağacınızdaki bu ve diğer tahminlerin doğru olup olmadığını anlayabiliyor musunuz?
  3. Niçin DNA’nın farklı alanlarını kullanarak oluşturulan filogenetik ağaçlar farklı görünebilir?
  4. Birbiri ile yakından ilişkili olan organizmaları kıyaslamak için DNA’nın hangi kısımlarını kullanmalısınız?
  5. Evrimsel olarak birbirinden uzak olan organizmaları kıyaslamak için ne tür genler kullanmalısınız?
  6. İki diziyi kıyaslıyor ve birinde silinme veya eklenme (delesyon veya insersiyon) olduğunu görürseniz ne yaparsınız?
  7. Çok farklı olan organizmaları bu basit kıyaslama metodu ile kıyaslayabilir miyiz? Tek bir nükleotid farkının ortya çıkmasının 20 milyon yıl aldığını varsaydığımızı düşünün.
  8. Evrim uzaklığını hesaplayan bu metodu kullanmanın çok iyi olmamasının diğer nedenlerini düşünebiliyor musunuz?
  9. Daha uzak organizmalarla çalışıyorsanız, DNA dizilimine göre amino asit dizilimlerini kıyaslamanın daha iyi olma nedenlerini düşünebiliyor musunuz?
  10. Bu alıştırmada birbirinden ayrılarak başkalaşım geçiren 5 primat türünü anlama üzerinde yoğunlaştık (ağaç ölçeği). Çoğu kez, ayrılan türlerde sırayı bile bilmiyoruz (ağaç şekli). Örneğin, insanlar ile şempanzelerin ilişkisinin goril ile şempanzelerin arasında olan ilişkiden daha yakın ilişkili olduğunu nasıl bilebiliriz? Eğer ikinci bahsedilen doğruysa, dizi farkı nasıl farklılık gösterecektir (Tablo 4)?

Teşekkür

Bu etkinlik, Avrupa Yaşam Bilimleri Öğrenme Laboratuvar (ELLS)w1 ile Avrupa Moleküler Biyoloji Laboratuarı E-STAR Fellows arasında özel bir işbirliği içinde geliştirilmiştir. Kleopatra Kozlowski, Avrupa Komisyonunun Erken Evre Araştırmacılar için olan 6. Çerçeve Programı Marie Curie e-STAR burs ile desteklenmiştir (MEST-CT-2004-504640).

Download

Download this article as a PDF

Web References

  • w1 – Avrupa Yaşam Bilimleri Öğğrenme Laboratuarı (ELLS) bir eğitim tesis olup, ilköğretim ve lise öğretmenlerine son teknolji moleküler biyoloji metodlarını vermeyi amaçlamaktadır. ELLS ayrıca öğretmenlerin bilim adamları ile çalışması için de fırsatlar sunmaktadır. Burada verilmiş olan aktivite bu bvağlamdadır. Daha çok bilgi için: www.embl.org/ells
  • w2 – Bu aktivite için gerekli olan tüm tabloları ve sorulara verilmiş olan cavpları buradan indirebilirsiniz.

Resources

Institution

EMBL

Review

Biz Biyoinformatik düşündüğümüz zaman muhtemelen büyük bilgisayarlar ve sıralama makinaları hayal ederiz ama buyeni bilimin yöntemleri Kleopatra Kozlowski’nin makalesinde olduğu gibi kağıt ve kalem ile basit sınıf aktiviteleri ile sunulabilir.

Yazar kısa (sahte) DNA dizileri arasındaki genetik farklılıkların temelinde insan ve diğer primatların aile ağacı binası ile bize meydan okuyor. Önerilen aktivite gibi evrim çalışmada moleküler saatlerin kullanımı gibi bazı zor biyoloji konuları ele için orta dereceli okullarda istismar (ve keyifle) kârlı olabilir.

Bu makale fen bilgisi öğretmenlerini de hedefliyor, metnin sonunda yararlı anlama egzersizleri bulacaksınız, öğrenciler de kendi anlayışlarını derişlentimek için soruları kullanabilir. Belirtilen web referanslarında daha fazla bilgi ve kaynak sağlanabilir.


Giulia Realdon, İtalya




License

CC-BY-NC-SA