Bioinformatyka z kartką i długopisem: jak zbudować drzewo filogenetyczne Teach article

Tłumaczenie Jadwiga Schreiber. Analizy bioinformatyczne wymagają zazwyczaj sprawnie działającego komputera. Mimo to Cleopatra Kozlowski pokaże nam jak przeprowadzić taką analizę i odnaleźć naszego ewolucyjnego przodka używając tylko kartki papieru i długopisu.

Zdjęcie dzięki uprzejmości
hometowncd / iStockphoto

Dzięki najnowszym osiągnięciom technologicznym stosunkowo łatwo i szybko można ustalić sekwencje DNA czy białka. Same sekwencje jednak niewiele nam mówią, na przykład: GAATCCA. Musimy wiedzieć co one oznaczają. Na przykład: Jakie białko jest kodowane przez daną sekwencję DNA? Czy ona w ogóle koduje jakieś białko? Jaki wpływ miałaby zmiana w sekwencji DNA na strukturę tego białka? Jaką funkcje ma to białko w komórce? Czy ta sekwencja DNA mówi nam coś o naszej ewolucji? A jeśli tak to co?

Odpowiedź na tego typu pytania oraz inne zagadnienia biologiczne można uzyskać za pomocą bioinformatyki: najczęściej poprzez porównanie sekwencji DNA czy białek – na przykład porównując nowo odkryte sekwencje z tymi, o których już stosunkowo dużo wiemy (być może mają one podobną funkcję?) lub porównując podobne sekwencje pomiędzy gatunkami.

Oczywiście bioinformatyka wymaga sprawnie działającego komputera. Jednak pozwalając komputerowi wykonać całą pracę nie zrozumiemy zasad funkcjonowania takich analiz. Dlatego też proponowane tutaj ćwiczenie jest do wykonania na papierze, by uczniowie mogli zrozumieć jak naprawdę działają analizy bioinformatyczne.

Artykuł ten zawiera jedno z czterech ćwiczeń. Dwa wprowadzające ćwiczenia (“Gene finding” i “Mutations”) oraz bardziej zaawansowane ćwiczenie („Mobile DNA”) można pobrać ze strony internetowej European Learning Laboratory for the Life Sciences (ELLS)w1. Wymagane do tych zadań tabele, objaśnienia ćwiczeń krok po kroku oraz propozycje pytań sprawdzających zrozumienie tematu można pobrać ze strony internetowej Science in Schoolw2.

Konstruowanie drzewa filogenetycznego

Akumulacja mutacji powoduje zmianę sekwencji DNA poprzez pokolenia. Przedstawione tutaj ćwiczenie zademonstruje nam jak możemy to wykorzystać by ustalić ewolucyjną zależność (odległość) między różnymi organizmami. Zajmie to ok 90 minut i wymaga niczego więcej jak tylko wspomnianych wyżej tabeli i długopisuw2.

Haeckel’s tree of life z The
Evolution of Man (1879)
.
Kliknij na obrazek aby
powiększyć

Zdjęcie z domeny publicznej,
źródło zdjęcia Wikimedia
Commons

Wprowadzenie

Jak sklasifikowałbyś różnego rodzaju zwierzęta? Tradycyjnie, ewolucyjną zależność pomiędzy zwierzętami określano na podstawie ich różnic morfologicznych na przykład posiadanie kręgosłupa czy skrzydeł. Taki podział może być jednak problematyczny. Ptaki, nietoperze i owady mają skrzydła ale czy to sprawia, że są one blisko spokrewnione? Jak można zatem dowiedzieć się w jakim stopniu różne organizmy są ze sobą spokrewnione i kiedy oddzieliły się one od wspólnego przodka?

Z badań DNA wiemy, że mutacje w materiale genetycznym powstają przypadkowo i stosunkowo rzadko oraz że są one przekazywane do następnego pokolenia. Zatem jeśli założymy, że wszyscy pochodzimy od wspólnego przodka, to dzięki porównaniu sekwencji homologicznych możemy oszacować kiedy poszczególne organizmy oddzieliły się od niego. Lub innymi słowami, im więcej czasu upłynęło od momentu oddzielenia się dwóch gatunków od wspólnego przodka tym więcej różnic znajdziemy w ich DNA.

Sekwencjami homologicznymi nazywamy te sekwencje DNA u dwóch różnych gatunków, które mają wspólne pochodzenie. W rzeczywistości nie mamy żadnego dowodu, że w ogóle jakaś sekwencja jest homologiczna – nie byliśmy świadkami zmian zachodzących w DNA. Jednak jeśli dwie sekwencje są wystarczająco do siebie podobne, zakładamy, że są one „homologiczne”. Żeby sprawdzić w jakim stopniu dwie sekwencje są do siebie podobne, trzeba je odpowiednio przyporządkować i porównać.

Zauważ, że różne regiony DNA – kodujące i niekodujące – ewoluowały w różnym tempie. Kodujące regiony ewolują (zmieniają się) stosunkowo wolno. Dlaczego? Jeśli mutacja spowoduje zmianę w białku (np. strukturze białka) to może to być dość kosztowne dla organizmu – być może zmniejszy to szansę jego przeżycia i/lub pozostawienie po sobie potomstwa. Temat ten omówiony jest w zadaniu „Mobile DNA.

By zailustrować zasadę homologii, skorzystamy z filologii (lingwistiki) – nauki o ewolucji języków. Istnieje bowiem wiele podobieństw w metodach używanych do badań ewolucji języków i ewolucji organizmów.

Drzewo języków indoeuropejskich. Zauważ, że choć indyjski, germański, romański i inne języki europejskie należą do jednej rodziny, fiński, estoński i węgierski należą do innej – uralskiej grupy języków. Kliknij na obrazek aby powiększyć
źródło danych: www.linguatics.com/indoeuropean_languages.htm

Szukanie różnic we fragmentach DNA pomiędzy organizmami jest jak porównywanie słowa znaczącego to samo w różnych językach, by zbadać jak blisko języki te są ze sobą spokrewnione.

Tabela 1: Słowo “kot” w językach indoeuropejskich
źródło informacji: http://cats-cat.blogspot.com

Ormiański gatz
Baskijski katu
Niderlandzki kat
Angielski cat
Estoński kass
Fiński kissa
Islandzki kottur
Włoski gatto
Norweski katt
Polski kot
Portugalski gato
Rosyjski kot
Hiszpański gato
Szwedzki katt

Na pewno zwróciłeś uwagę, że słowo “kot” po włosku, hiszpańsku i portugalsku brzmi prawie tak samo: gatto, gato i gato. W języku szwedzkim i norweskim kot jest „katt” ale zwróć uwagę, że w języku fińskim to „kissa”. Choć Finlandia jak Szwecja i Norwegia jest krajem nordyckim, fińskie słowo kot jest bardziej podobne to estońskiego słowa „kass”. Rzeczywiście języki te są ze sobą spokrewnione. Zatem, porównując jak konkretne słowo zmieniło się z czasem i regionem, możemy oszacować związek pomiędzy różnymi językami.

Zdjęcie dzięki uprzejmości
Stephan Franz Xaver Dietl /
pixelio.de

Budowa drzewa filogenetycznego ssaków naczelnych

W zadaniu tym skonstrułujemy drzewo filogenetyczne używając pięciu homologicznych sekwencji DNA należących do ssaków naczelnych. Ponieważ sekwencje te są fikcyjne, nie możemy użyć ich do określenia prawdziwego dystansu genetycznego tych ssaków; aby zbudować prawdziwe drzewo filogenetyczne wymagane są dużo dłuższe sekwencje genetyczne. Nie mniej jednak te fikcyjne sekwencje (patrz tabelka nr. 2) zostały tak dobrane by ukazać nam w miarę rzeczywiste powiązanie pomiędzy tymi gatunkami.

Uwaga: wszystkie potrzebne do wykonania tego zadania tabelki można pobrać ze strony internetowej Science in Schoolw2.

Ssaki naczelne Sekwencje

Tabela 2: Pięć sekwencji DNA ssaków naczelnych

Neandertalczyk (n) TGGTCCTGCAGTCCTCTCCTGGCGCCCCGGGCGCGAGCGGTTGTCC
Człowiek (h) TGGTCCTGCTGTCCTCTCCTGGCGCCCTGGGCGCGAGCGGATGTCC
Szympans (c) TGATCCTGCAGTCCTCTTCTGGCGCCCTGGGCGCGTGCGGTTGTCC
Goryl (g) TGGACCTGCAGTCATCTTCTGCCCGCCCGAGCGCTTGCCGATGTCC
Orangutan (o) ACAACCTGCACTCCTATTCTGCCGAGCCGGGCGCGTGGCAAAGTCC
  1. Policz różnice w sekwencjach każdej z par i zapisz je w tabelce nr. 4. Można to łatwo zrobić porównując sekwencje jedna pod drugą. Na przykład pomiędzy sekwencjami Neandertalczyka i człowieka występują trzy różnice (Tabela 3a) a pomiędzy szympansem i gorylem 11 (Tabela 3b).

Tabela 3a: Porównanie sekwencji Neandertalczyka i człowieka.

Neandertalczyk TGGTCCTGCAGTCCTCTCCTGGCGCCCCGGGCGCGAGCGGTTGTCC
Człowiek TGGTCCTGCTGTCCTCTCCTGGCGCCCTGGGCGCGAGCGGATGTCC

Tabela 3b: Porównanie sekwencji szympansa i goryla.

Szympans TGATCCTGCAGTCCTCTTCTGGCGCCCTGGGCGCGTGCGGTTGTCC
Goryl TGGACCTGCAGTCATCTTCTGCCCGCCCGAGCGCTTGCCGATGTCC

Tabele porównawcze dla wszystkich par gatunków oraz tabelę sumującą różnice między nimi można pobrać ze strony internetowej Science in Schoolw2.

Neandertalczyk Człowiek Szympans Goryla Orangutan

Tabela 4: Różnice w sekwencjach między ssakami naczelnymi

Neandertalczyk 0 3      
Człowiek 3 0      
Szympans     0 11  
Goryl     11 0  
Orangutan          

Dzieląc liczbę różnic w nukleotydach w sekwencjach pomiędzy dwoma gatunkami przez całkowitą liczbę nukleotydów w każdej z sekwencji (w tym wypadku 46) uzyskamy stosunkową odległość genetyczną między tymi sekwencjami (gatunkami).

  1. Rozważ dwa gatunki z najbardziej podobnymi sekwencjami: Neandertalczyk i człowiek. W tabelce nr. 5, zapisz liczbę różnic w nukleotydach (3) i stosunkową odległość między nimi (3/46=0.065).
Różnice Stosunkowa różnica (odległość)

Tabela 5: Ewolucyjna odległość między przodkami naczelnych i obecnymi naczelnymi

Neandertalczyk i człowiek 3 3/46 = 0.065
Neandertalczyk / człowiek i szympans    
Neandertalczyk / człowiek / szympans i goryl    
Neandertalczyk / człowiek / szympans / goryl i orangutan    

Zakłada się, że “średnia różnica” w sekwencjach dwóch gatunków przedstawia ich przodka. W tym ćwiczeniu nie obliczamy bezpośrednio średniej różnicy pomiędzy np. Neandertalczykiem i człowiekiem, a ewolucyjną odległość pomiędzy przodkiem Neandertalczyka / człowieka i wszystkimi innymi naczelnych z naszej grupy.

  1. Oblicz odległość pomiędzy średnią (różnicą) sekwencją Neandertalczyków i ludzi oraz innych naczelnych z tej grupy a wyniki wpisz w tabelka nr. 6a.
    4 różnice występują pomiędzy Neandertalczykiem i szympansem oraz 5 różnic pomiędzy człowiekiem i szympansem – zatem średnia odległość pomiędzy Neandertalczykiem / człowiekiem i szympansem jest 4.5 ((5+4)/2=4.5).
    11 różnic występuje pomiędzy Neandertalczykiem i gorylem oraz 12 różnic pomiędzy człowiekiem i gorylem – zatem średnia odległość pomiędzy Neandertalczykiem / człowiekiem i gorylem wynosi 11.5 ((11+12)/2=11.5).
  Neandertalczyk/ człowiek Szympans Goryl Orangutan

Tabela 6a: Różnice w sekwencji pomiędzy przodkami Neandertalczyka / człowieka i innymi naczelnymi

Neandertalczyk/ człowiek 0 (4+5)/2 = 4.5 (11+12)/2=11.5  
Szympans (4+5)/2 = 4.5 0    
Goryl (11+12)/2=11.5   0  
Orangutan        
  1. Obliczoną w ten sposób (średnią) odległość ewolucyjną (Tabelka nr. 6a) możemy zamienić w stosunkową różnicę (odległość) dzieląc ją przez całkowitą liczbę nukleotydów (46), jak obliczyliśmy wcześniej dla Neandertalczyka i człowieka (patrz Tabelka nr. 5). Oblicz stosunkową odległość pomiędzy średnimi sekwencjami Neandertalczyka / człowieka i innych naczelnych. Zapisz wyniki w tabelce nr. 5.
    Dla szympansa stosunkowa odległość od przodka Neandertalczyka / człowieka wynosi 4.5/46=0.98.

Teraz na podstawie danych z tabeli nr. 5, możemy budować drzewo ewolucyjne (zobacz rysunek nr. 2).

  1. Połącz Neandertalczyka i człowieka linią. Długość tej gałęzi powinna być proporcjonalna do czasu jaki zajęło człowiekowi i Neandertalczykowi by oddzielić się od wspólnego przodka.

    Załużmy, że 20 milionów lat musi upłynąć dla jednego nukleotydu, w danej sekwencji DNA, by uległ on zmianie. Aby sekwencja DNA zmieniła się o 0.065, upłynie 0.065*20 milionów = 1.3 milionów lat. Zatem długość tej gałęzi odzwierciedla 1.3 milionów lat na skali czasu (zobacz rysunek 2).

  2. Aby obliczyć jak dawno temu oddzielił się przodek szympansa od przodka człowieka (jak długa będzie ta linia) dodaj ich stosunkowe różnice z tabeli nr. 5.
    Stosunkowa odległość pomiędzy przodkiem Neandertalczyka / człowieka i szympansa wynosi 0.98 a pomiędzy Neandertalczykiem i człowiekiem 0.065. Zatem czas oddzielenia się szympansa, człowieka i Neandertalczyka od wspólnego przodka jest następujący:
    (0.065 + 0.098) * 20 milionów
    = 0.163 * 20 milionów
    = 3.3 milionów lat temu.
Rysunek 2: Rozpoczęte drzewo filogenetyczne
Zdjęcie dzięki uprzejmości Nicola Graf
  1. Kontynułuj obliczenia powtarzając kroki nr. 3 i 6 by obliczyć jak dawno przodek Neandertalczyka/człowieka/szympansa oddzieliły się od goryla i orangutana. Następnie oblicz jak dawno temu przodek Neandertalczyka/człowieka/szympansa/goryla oddzielił się od orangutana. Zapisz wszystkie wyniki w tabeli nr. 5.
    Jeśli potrzebujesz pomocy w obliczeniach, pobierz wyjaśnienie „krok po kroku” ze strony internetowej Science in School.
  2. Całkowicie wypełniona tabela 5 pomoże Ci dokończyć rozpoczęte na stronie 33 drzewo ewolucyjne (Porównaj rysunek 2 i 3).
Rysunek 3. Uzupełnione drzewo filogenetyczne
Zdjęcie dzięki uprzejmości Nicola Graf

Pytania

BPoniżej znajdują się przykładowe pytania sprawdzające zrozumienie przez uczniów powyższego ćwiczenia. Proponowane odpowiedzi są do pobrania ze strony internetowej Science in Schoolw2.

  1. Jak dawno temu w Twoim drzewie filogenetycznym goryl i człowiek oddzielili się od wspólnego przodka? A orangutan i człowiek?
  2. Jak możesz sprawdzić, że te i inne obliczenia w Twoim drzewie są poprawne?
  3. Dlaczego jeśli skonstruowałbyś drzewo filogenetyczne używając innych sekwencji/rejonów DNA, wyglądałoby ono inaczej?
  4. Jakich regionów DNA powinieneś użyć by porównać organizmy blisko ze sobą spokrewnione?
  5. Jakich genów powinieneś użyć by porównać organizmy, które są ewolucyjnie odległe od siebie?
  6. Co powinieneś zrobić jeśli porównując sekwencje zauważysz ze jedna z nich ma braki w wyniku np. delecji (lub insercji w innych sekwencjach)?
  7. Zastanów się dlaczego ta prosta metoda porównywania liczby różnic w nukleotydach mogłaby być nieodpowiednia dla organizmów, które bardzo się od siebie różnią? Pamiętaj, zakłada się, że 20 milionów lat musi upłynąć dla pojedynczego nukleotydu w sekwencji by uległ on zmianie.
  8. Zastanów się nad innymi powodami dlaczego metoda ta nie jest najlepszą do obliczania ewolucyjnej odległości między organizmami? Jakie uproszczenia zostały tu zastosowane?
  9. Zastanów się dlaczego porównując bardziej odległe od siebie organizmy lepiej jest porównywać sekwencje aminokwasów niż sekwencje DNA?
  10. W ćwiczeniu tym skoncentrowaliśmy się na obliczaniu kiedy pięć naszych przykładowych naczelnych oddzieliło się jedno od drugiego (zobacz skala Twojego drzewa). Często jednak nie wiemy w jakiej kolejności gatunki się oddzieliły (jak wygląda prawdziwe drzewo filogenetyczne). Skąd zatem wiemy, że człowiek i szympans są bardziej ze sobą spokrewnione niż goryl i szympans? Jeśli to drugie byłoby prawdą, jak wyglądałyby różnice w sekwencjach pomiędzy nimi (zobacz tabelka nr. 4)?

Podziękowania

Ćwiczenie to zostało opracowane dzięki współpracy European Learning Laboratory for the Life Sciences (ELLS)w1 i European Molecular Biology Laboratory’s E-STAR Fellows – organizacji opracowujących materiały dydatkyczne. Działalność Cleopatry Kozlowski sponsorowana jest przez European Commission’s Framework Programme 6 Marie Curie Host Fellowship for Early Stage Research Training, numer projektu MEST-CT-2004-504640.

Download

Download this article as a PDF

Web References

  • w1 – The European Learning Laboratory for the Life Sciences (ELLS) jest organizacją edukacyjną umożliwiającą nauczycielom szkół średnich zapoznanie się w laboratoriach naukowych z najnowszymi technikami biologii molekularnej. Dodatkowo dzięki ELLS naukowcy mogą współpracować z nauczycielami i być może tym sposobem zmniejszyć przepaść istniejącą między badanami naukowymi a edukacją szkolną. Przedstawione tutaj ćwiczenie zostało opracowane jako część programu dla dokształcającego nauczycieli zorganizowanego przez ELLS. Więcej informacji na temat ELLS można znaleźć na stronie: www.embl.org/ells
  • w2 – Wszystkie tabele potrzebne do wykonania tego ćwiczenia oraz opis jego wykonania krok po kroku można pobrać ze strony internetowej Science in School, zobacz.

Resources

Institution

EMBL

Review

Kiedy słyszymy o bioinformatyce od razu wyobrażamy sobie skomplikowane programy komputerowe i maszyny sekwencjujące DNA. Ale metody używane w tej stosunkowo nowej dziedzinie naukowej można zaprezentować za pomocą prostych ćwiczeń wymagających tylko kartki papieru i długopisu.

Cleopatra Kozlowski zachęca nas i prezentuje jak zbudować drzewo filogenetyczne człowieka i innych ssaków naczelnych na podstawie różnic genetycznych w krótkich (przykładowych) sekwencjach DNA. Zaproponowane ćwiczenie (zabawa) można użyć jako materiał dydaktyczny do omówienia trudnych tematów biologicznych jak ewolucja czy znaczenie zegara molekularnego.

Artykuł ten zawiera również interesujące propozycje pytań sprawdzających zrozumienie tematu dla nauczycieli i uczniów. Podane referencje internetowe oferują dodatkowe informacje o ewolucji i tematach z nią związanych.


Giulia Realdon, Włochy




License

CC-BY-NC-SA