Βιοπληροφορική με μολύβι και χαρτί: κατασκευάζοντας ένα φυλογενετικό δέντρο Teach article

Μετάφραση από Εύα- Βασιλική Βίτσα (Eva-Vasiliki Vitsa). Συνήθως για την Βιοπληροφορική χρησιμοποιούνται ισχυροί ηλεκτρονικοί υπολογιστές. Κι όμως, με τη βοήθεια της…

Η εικόνα προσφέρθηκε από
hometowncd / iStockphoto

Χάρη στην πρόοδο της τεχνολογίας, ο προσδιορισμός της αλληλουχίας ενός μορίου DNA ή μιας πρωτεΐνης είναι σχετικά εύκολη και γρήγορη διαδικασία. Αυτές καθαυτές οι αλληλουχίες βέβαια μας λένε πολύ λίγα: GAATCCA για παράδειγμα. Πρέπει να μάθουμε ποια είναι η σημασία αυτών των αλληλουχιών. Ποιες πρωτεΐνες κωδικοποιούνται από αυτή την αλληλουχία DNA και αν κωδικοποιεί αυτή η αλληλουχία κάποια πρωτεΐνη τελικά. Τι επίδραση έχει στη δομή της κωδικοποιούμενης πρωτεΐνης μια μικρή αλλαγή στην αλληλουχία του DNA; Ποια λειτουργία επιτελεί αυτή η πρωτεΐνη στο κύτταρο και προπάντων πως μπορεί η αλληλουχία του DNA μας να μιλήσει για την εξελικτική μας ιστορία;

Αυτά και άλλα σημαντικά βιολογικά ζητούμενα μπορούν να προσεγγιστούν με τη Βιοπληροφορική. Βασικά αυτό γίνεται συγκρίνοντας μεταξύ τους αλληλουχίες DNA ή πρωτεϊνών – για παράδειγμα συγκρίνοντας νεοανακαλυπτόμενες αλληλουχίες με άλλες για τις οποίες έχουμε ήδη πολλές πληροφορίες ώστε να εξακριβώσουμε αν λειτουργούν με παρόμοιο τρόπο, ή συγκρίνοντας παρόμοιες αλληλουχίες που απαντούν σε διαφορετικά είδη οργανισμών

Κανονικά, βέβαια, η Βιοπληροφορική διεξάγεται με τη βοήθεια ενός ισχυρού ηλεκτρονικού υπολογιστή. Είναι όμως υπερβολικά εύκολο να αναθέσει κανείς σε έναν υπολογιστή να κάνει όλη τη δουλειά χωρίς να αντιλαμβάνεται τις αρχές που διέπουν το θεωρητικό υπόβαθρο. Γι αυτό το λόγο τούτες οι δραστηριότητες έχουν σχεδιαστεί για να πραγματοποιηθούν στο χαρτί, έτσι ώστε να κατανοήσουν οι μαθητές πώς λειτουργεί η Βιοπληροφορική ανάλυση.

Αυτό το άρθρο περιλαμβάνει τη μία δραστηριότητα από μια ομάδα τεσσάρων. Οι δύο εισαγωγικές δραστηριότητες («Βρίσκοντας το γονίδιο» και «Μεταλλάξεις») και η τελική δραστηριότητα («Κινητό DNA») μπορούν να μεταφορτωθούν από τον ιστοχώρο του European Learning Laboratory for the Life Sciences (ELLS)w1. Όλοι οι πίνακες που χρειάζονται οι μαθητές ώστε να ολοκληρώσουν αυτή τη δραστηριότητα, μαζί με την περιγραφή της διαδικασίας βήμα προς βήμα και τις απαντήσεις στις ερωτήσεις κατανόησης μπορούν να μεταφορτωθούν από τον ιστοχώρο του περιοδικού Science in Schoolw2.

Κατασκευάζοντας ένα φυλογενετικό δέντρο

Η συσσώρευση μεταλλάξεων έχει ως αποτέλεσμα να μεταβάλλονται οι αλληλουχίες του DNA καθώς εναλλάσσονται οι γενιές. Η ακόλουθη δραστηριότητα καταδεικνύει τον τρόπο με τον οποίο αυτό μπορεί να χρησιμοποιηθεί για να εξακριβωθούν οι φυλογενετικές σχέσεις μεταξύ των οργανισμών. Διαρκεί περίπου 90 λεπτά και δεν απαιτείται παρά μόνο ένα μολύβι και οι πίνακες που μπορούν να μεταφορτωθούν από τον ιστοχώρο του περιοδικού Science in Schoolw2.

Εισαγωγή

Το Δέντρο της Ζωής του
Χαίκελ, από The Evolution of
Man (1879)
. Κάντε κλικ στην
εικόνα για μεγέθυνση

Εικόνα από ελεύθερο στο
κοινό Ιστοχώρο; Πηγή
εικόνας: Wikimedia Commons

Σκεφτείτε πώς θα μπορούσατε να κατηγοριοποιήσετε διαφορετικά μεταξύ τους ζώα. Παραδοσιακά έχουν χρησιμοποιηθεί οι φυσικές μορφολογικές διαφορές των οργανισμών για να τεκμηριωθούν οι εξελικτικές σχέσεις μεταξύ τους, για παράδειγμα αν ο οργανισμός έχει σπονδυλική στήλη ή αν έχει πτέρυγες. Αυτό όμως μπορεί να δημιουργήσει προβλήματα. Για παράδειγμα, πτέρυγες διαθέτουν τα πτηνά, οι νυχτερίδες και τα έντομα, είναι όμως στενοί συγγενείς μεταξύ τους; Πώς προσδιορίζει κανείς πόσο πρόσφατα διαφοροποιήθηκαν οι οργανισμοί από έναν κοινό πρόγονο;

Γνωρίζουμε από μελέτες προσδιορισμού των αλληλουχιών DNA ότι οι μεταλλάξεις προκύπτουν τυχαία και με πολύ αργό ρυθμό και μεταβιβάζονται από τους γονείς στους απογόνους. Επομένως, αν υποθέσουμε ότι όλοι οι οργανισμοί έχουν έναν κοινό πρόγονο, μπορούμε να χρησιμοποιήσουμε τις διαφορές στις ομόλογες αλληλουχίες για να προσδιορίσουμε πόσος χρόνος έχει περάσει από τότε που απέκλιναν εξελικτικά οι οργανισμοί. Με άλλα λόγια, όσο περισσότερος χρόνος έχει περάσει από τότε που απέκλιναν δύο είδη από τον κοινό τους πρόγονο, τόσο περισσότερο θα διαφέρουν οι αλληλουχίες του DNA τους.

Ως ομόλογες αλληλουχίες σε δυο οργανισμούς χαρακτηρίζονται εκείνες που έχουν κοινή προέλευση. Στην πραγματικότητα δεν έχουμε απόδειξη ότι κάποιες αλληλουχίες είναι ομόλογες μεταξύ τους ( αφού δεν ήμασταν εκεί για να παρακολουθούμε πώς άλλαζε το DNA με την πάροδο του χρόνου) αλλά αν έχουν ικανοποιητική ομοιότητα, συχνά υποθέτουμε ότι είναι «ομόλογες». Για να βρούμε πόσο παρόμοιες είναι δυο αλληλουχίες πρέπει να τις τοποθετήσουμε ευθυγραμμίζοντας τις με το σωστό τρόπο (αλλά αυτό δεν αποτελεί τμήμα αυτής της δραστηριότητας).

Πρέπει να επισημάνουμε ότι οι διαφορετικές περιοχές του DNA –κωδικοποιούσες και μη κωδικοποιούσες περιοχές – εξελίσσονται με διαφορετικές ταχύτητες. Γενικά οι κωδικοποιούσες περιοχές εξελίσσονται πιο αργά, επειδή οι μεταλλάξεις που αφορούν πρωτεΐνες είναι γενικά επιβλαβείς για τους οργανισμούς- λιγοστεύουν οι πιθανότητες τους για επιβίωση και δημιουργία απογόνων. Αυτό το θέμα συζητείται στη Δραστηριότητα «Κινητό DNA»

Για να απεικονίσουμε την έννοια της ομολογίας μπορούμε να χρησιμοποιήσουμε ένα παράδειγμα από τη φιλολογία, από τη μελέτη της εξέλιξης των γλωσσών. Στην πράξη υπάρχει παράλληλη σχέση μεταξύ των μεθόδων που χρησιμοποιούνται για τη μελέτη της εξέλιξης των γλωσσών και των οργανισμών.

Το δέντρο των ινδοευρωπαϊκών γλωσσών. Επισημαίνεται ότι η Ινδική, η Γερμανική, η Ρομανική και πολλές άλλες Ευρωπαϊκές γλώσσες ανήκουν σε αυτή την οικογένεια, ενώ η Φινλανδική, η Εσθονική και η Ουγγρική όχι. Αυτές ανήκουν στην ομάδα των Ουραλικών γλωσσών. Πατήστε για να μεγεθύνετε την εικόνα- τοποθετήστε τη στο κέντρο
Πηγή: http://www.linguatics.com/indoeuropean_languages.htm

Το να χρησιμοποιούνται οι διαφορές που παρουσιάζουν κάποια τμήματα αλληλουχιών DNA μεταξύ τους μοιάζει λίγο με το να συγκρίνονται λέξεις που έχουν την ίδια σημασία σε διαφορετικές γλώσσες, για να διαπιστωθεί αν είναι συγγενείς μεταξύ τους οι γλώσσες αυτές.

Πίνακας 1. Λίστα για τη λέξη «γάτα» στις Ινδοευρωπαϊκές γλώσσες
Πηγή: http://cats-cat.blogspot.com

Αρμενικά gatz – γκατζ
Βασκικά katu – κάτου
Ολλανδικά kat – κατ
Αγγλικά cat – κατ
Εσθονικά kass – κασς
Φινλανδικά kissa – κίσσα
Ισλανδικά kottur – κόττουρ
Ιταλικά gatto – γκάττο
Νορβηγικά katt – καττ
Πολωνικά kot – κοτ
Πορτογαλικά gato – γκάτο
Ρωσικά kot – κοτ
Ισπανικά gato – γκάτο
Σουηδικά katt – καττ

Μπορείτε να δείτε ότι η λέξεις για τη «γάτα» στα Ιταλικά, Ισπανικά και Πορτογαλικά είναι σχεδόν ίδιες: γκάττο, γκάτο και γκάτο. Στα Σουηδικά και στα Νορβηγικά, η λέξη είναι «καττ», ενώ στα Φινλανδικά είναι διαφορετική: «κίσσα». Μολονότι η Φινλανδία είναι χώρα του Αρκτικού κύκλου, όπως η Σουηδία και η Νορβηγία, η φινλανδική λέξη για τη γάτα μοιάζει περισσότερο με την εσθονική λέξη «κασς».Πράγματι οι δύο γλώσσες έχουν στενή συγγένεια. Μπορεί κανείς λοιπόν να μάθει κάποια πράγματα για τις συγγένειες μεταξύ των γλωσσών μελετώντας πώς έχουν μεταβληθεί οι λέξεις με την πάροδο του χρόνου

Η εικόνα προσφέρθηκε από
Stephan Franz Xaver Dietl /
pixelio.de

Κατασκευάζοντας ένα φυλογενετικό δέντρο πρωτευόντων

Σε αυτή τη δραστηριότητα θα κατασκευάσουμε ένα φυλογενετικό δέντρο χρησιμοποιώντας πέντε ομόλογες αλληλουχίες DNA από πρωτεύοντα. Οι αλληλουχίες έχουν επινοηθεί, δεν είναι πραγματικές, γι αυτό δεν μπορούμε να καταλήξουμε σε πραγματικές εκτιμήσεις για τη γενετική απόσταση. Θα χρειαζόμασταν πολύ μεγαλύτερου μήκους αλληλουχίες προκειμένου να κατασκευάσουμε με πραγματικά δεδομένα ένα σωστό φυλογενετικό δέντρο. Ωστόσο, οι φανταστικές μας αλληλουχίες (στον Πίνακα 2) έχουν επιλεγεί έτσι ώστε να δώσουν μια αρκετά ακριβή εικόνα των σχέσεων μεταξύ των πρωτευόντων.

Σημείωση: όλοι οι πίνακες που απαιτούνται για να ολοκληρώσουν οι μαθητές αυτή τη δραστηριότητα μπορούν να μεταφορτωθούν από τον ιστοχώρο του περιοδικού Science in Schoolw2.

Πρωτεύον Αλληλουχία
Πίνακας 2: Πέντε αλληλουχίες DNA από πρωτεύοντα
Άνθρωπος του Νεάντερταλ (n) TGGTCCTGCAGTCCTCTCCTGGCGCCCCGGGCGCGAGCGGTTGTCC
Σύγχρονος Άνθρωπος (h) TGGTCCTGCTGTCCTCTCCTGGCGCCCTGGGCGCGAGCGGATGTCC
Χιμπατζής (c) TGATCCTGCAGTCCTCTTCTGGCGCCCTGGGCGCGTGCGGTTGTCC
Γορίλας (g) TGGACCTGCAGTCATCTTCTGCCCGCCCGAGCGCTTGCCGATGTCC
Ουρανκοτάγκος (o) ACAACCTGCACTCCTATTCTGCCGAGCCGGGCGCGTGGCAAAGTCC
  1. Μετρήστε τον αριθμό των διαφορών ανάμεσα σε κάθε ζεύγος αλληλουχιών και καταγράψτε το στον Πίνακα 4. Αυτό είναι εύκολο να το κάνετε αν τοποθετήσετε τις συγκρινόμενες αλληλουχίες τη μια δίπλα στην άλλη. Για παράδειγμα ο Νεάντερταλ και ο σύγχρονος άνθρωπος διαφέρουν σε τρία νουκλεοτίδια στην αλληλουχία (Πίνακας3a) ενώ ο χιμπατζής και ο γορίλας διαφέρουν σε 11 σημεία (Πίνακας 3b).
Πίνακας 3α: Σύγκριση των αλληλουχιών Νεάντερταλ και Σύγχρονου Ανθρώπου
Άνθρωπος του Νεάντερταλ TGGTCCTGCAGTCCTCTCCTGGCGCCCCGGGCGCGAGCGGTTGTCC
Σύγχρονος Άνθρωπος TGGTCCTGCTGTCCTCTCCTGGCGCCCTGGGCGCGAGCGGATGTCC
Πίνακας 3β: Σύγκριση των αλληλουχιών Χιμπατζή και Γορίλα
Χιμπατζής TGATCCTGCAGTCCTCTTCTGGCGCCCTGGGCGCGTGCGGTTGTCC
Γορίλας TGGACCTGCAGTCATCTTCTGCCCGCCCGAGCGCTTGCCGATGTCC

Πίνακες σύγκρισης για όλα τα ζεύγη ειδών και ο συμπληρωμένος πίνακας των διαφορών στις αλληλουχίες ( Πίνακας 4) μπορούν να μεταφορτωθούν από τον ιστοχώρο του περιοδικού Science in School websitew2.

Άνθρωπος του Νεάντερταλ Σύγχρονος Άνθρωπος Χιμπατζής Γορίλας Ουρανκοτάγκος
Πίνακας 4: Διαφορές μεταξύ αλληλουχιών πρωτευόντων
Άνθρωπος του Νεάντερταλ 0 3      
Σύγχρονος Άνθρωπος 3 0      
Χιμπατζής     0 11  
Γορίλας     11 0  
Ουρανκοτάγκος          

Ο αριθμός των νουκλεοτιδίων στα οποία διαφέρουν δύο αλληλουχίες διαιρούμενος με το συνολικό αριθμό των νουκλεοτιδίων σε κάθε αλληλουχία (σε αυτή την περίπτωση 46) δίνει την αναλογική (proportional) απόσταση ανάμεσα στις δύο αλληλουχίες.

  1. Ας δούμε τα δύο είδη με τις περισσότερο όμοιες αλληλουχίες: Άνθρωπος του Νεάντερταλ και Σύγχρονος Άνθρωπος. Στον Πίνακα 5, καταχωρήστε τον αριθμό των διαφορετικών νουκλεοτιδίων (3) και την αναλογική διαφορά (3/46 = 0.065).
Διαφορές Αναλογική διαφορά
Πίνακας 5: Εξελικτικές αποστάσεις μεταξύ των προγόνων των Πρωτευόντων και των Πρωτευόντων
Άνθρωπος του Νεάντερταλ και Σύγχρονος Άνθρωπος 3 3/46 = 0.065
Άνθρωπος του Νεάντερταλ / Σύγχρονος Άνθρωπος και Χιμπατζής    
Άνθρωπος του Νεάντερταλ/ Σύγχρονος Άνθρωπος/ Χιμπατζής και Γορίλας    
Άνθρωπος του Νεάντερταλ / Σύγχρονος Άνθρωπος / Χιμπατζής / Γορίλας και Ουρανκοτάγκος    

Υποθέτουμε ότι η «μέση τιμή αλληλουχίας» (‘average sequence’) δύο ειδών είναι η προγονική αλληλουχία. Σε αυτή την άσκηση δεν υπολογίζουμε άμεσα τη μέση τιμή αλληλουχίας του Ανθρώπου του Νεάντερταλ και του Σύγχρονου Ανθρώπου π.χ., αλλά την εξελικτική απόσταση ανάμεσα στον πρόγονο των Neanderthal / human και σε όλα τα άλλα πρωτεύοντα της ομάδας.

  1. Υπολογίστε την απόσταση ανάμεσα στη μέση τιμή αλληλουχίας των Νεαντερτάλιων και Σύγχρονων Ανθρώπων, και των άλλων ειδών των πρωτευόντων και καταχωρήστε τα δεδομένα στον Πίνακα 6a.
    Υπάρχουν τέσσερις διαφορές μεταξύ Νεάντερταλ και χιμπατζή και πέντε διαφορές μεταξύ Ανθρώπου και χιμπατζή. Επομένως η μέση απόσταση μεταξύ Νεάντερταλ/Ανθρώπου και χιμπατζή είναι 4.5.
    Υπάρχουν 11 διαφορές μεταξύ Νεάντερταλ και γορίλα, και 12 διαφορές μεταξύ Ανθρώπου και γορίλα. Επομένως η μέση απόσταση μεταξύ Νεάντερταλ/Ανθρώπου και γορίλα είναι 11.5.
  Νεάντερταλ/ Σύγχρονος Άνθρωπος Χιμπατζής Γορίλας Ουρανκοτάγκος
Πίνακας 6α: Διαφορές ανάμεσα στις αλληλουχίες του προγόνου Νεάντερταλ/Ανθρώπου και άλλων Πρωτευόντων
Νεάντερταλ/ Σύγχρονος Άνθρωπος 0 (4+5)/2 = 4.5 (11+12)/2=11.5  
Χιμπατζής (4+5)/2 = 4.5 0    
Γορίλας (11+12)/2=11.5   0  
Ουρανκοτάγκος        
  1. Όπως πριν, αυτές οι αποστάσεις μπορούν να μετατραπούν σε αναλογικές διαφορές διαιρώντας τις με τον αριθμό των νουκλεοτιδίων σε κάθε αλληλουχία (46). Υπολογίστε τις αναλογικές αποστάσεις ανάμεσα στη μέση τιμή αλληλουχίας Νεάντερταλ/Ανθρώπου, και των άλλων ειδών Πρωτευόντων. Καταχωρήστε τις τιμές στον Πίνακα 5.
    Για τους Χιμπατζήδες η αναλογική απόσταση από τον πρόγονο των Νεάντερταλ/Ανθρώπου είναι 4.5/46 = 0.98.

Χρησιμοποιώντας τον Πίνακα 5, μπορείτε να αρχίσετε να κατασκευάζετε το φυλογενετικό δέντρο.

  1. Συνδέστε με μια γραμμή τους Νεαντερτάλιους και τους Σύγχρονους Ανθρώπους. Το μήκος του κλάδου θα πρέπει να αντιστοιχεί στο χρονικό διάστημα που απαιτήθηκε για την απόκλιση των Σύγχρονων ανθρώπων και των Νεάντερταλ από τον κοινό τους πρόγονο.

    Ας υποθέσουμε ότι για να αλλάξει ένα μόνο νουκλεοτίδιο σε αυτή τη συγκεκριμένη αλληλουχία DNA απαιτήθηκε χρονικό διάστημα 20 εκατομμυρίων ετών. Συνεπώς για να αλλάξει η αλληλουχία DNA κατά 0.065, θα χρειάστηκαν 0.065*20 εκ. = 1.3 εκ. έτη. Ο κλάδος θα πρέπει επομένως να αντιστοιχεί σε 1.3 εκ έτη στην κλίμακα του χρόνου (βλέπε Εικόνα 2).

  2. Για να υπολογίσετε πόσα χρόνια πριν απέκλινε ο πρόγονος των χιμπατζήδων από των πρόγονο των ανθρώπων (το μήκος του κλάδου), αθροίστε τις αναλογικές διαφορές στον πίνακα 5.
    Να θυμάστε ότι η αναλογική απόσταση μεταξύ του προγόνου των Νεάντερταλ/Ανθρώπου και του χιμπατζή ήταν 0.98. Συνεπώς οι χιμπατζήδες, οι Σύγχρονοι Άνθρωποι και οι Νεάντερταλ απέκλιναν από έναν κοινό πρόγονο πριν από:
    (0.065 + 0.098) * 20 εκ
    = 0.163 * 20 εκ
    = 3.3 εκ. χρόνια.
Εικόνα2: Ατελές φυλογενετικό δέντρο
Η εικόνα προσφέρθηκε από Nicola Graf
  1. Συνεχίστε τους υπολογισμούς. Επαναλάβετε τα βήματα 3 έως 6 για να υπολογίσετε πριν πόσον καιρό ο πρόγονος των Νεάντερταλ/Ανθρώπου/χιμπατζή απέκλινε από τον γορίλα και από τον Ουρανκοτάγκο. Κατόπιν υπολογίστε πόσον καιρό πριν απέκλινε ο πρόγονος των Νεάντερταλ/Ανθρώπου/ χιμπατζή/γορίλα από τον Ουρανκοτάγκο. Καταχωρήστε τα αποτελέσματα στον Πίνακα 5.
    Αν χρειαστείτε βοήθεια, μπορείτε να κατεβάσετε την όλη διαδικασία βήμα προς βήμα από τον ιστοχώρο Science in School.
  2. Χρησιμοποιείστε τον συμπληρωμένο πίνακα 5 για να ολοκληρώσετε το φυλογενετικό δέντρο, όπως φαίνεται στην σελίδα 33.
Εικόνα3: Πλήρες φυλογενετικό δέντρο
Η εικόνα προσφέρθηκε από Nicola Graf

Ερωτήσεις

Μπορείτε να χρησιμοποιήσετε τις παρακάτω ερωτήσεις για να ελέγξετε αν οι μαθητές σας έχουν κατανοήσει τη δραστηριότητα. Οι απαντήσεις μπορούν να μεταφορτωθούν από τον ιστοχώρο Science in Schoolw2.

  1. Στο φυλογενετικό σας δέντρο, πριν από πόσα χρόνια απέκλιναν οι γορίλες και οι άνθρωποι από τον κοινό τους πρόγονο; Οι Ουρανκοτάγκοι και οι άνθρωποι;
  2. Μπορείτε να βρείτε αν αυτές και άλλες εκτιμήσεις στο φυλογενετικό σας δέντρο είναι σωστές;
  3. Γιατί μπορεί να φαίνονται διαφορετικά τα φυλογενετικά δέντρα που κατασκευάστηκαν με χρήση διαφορετικών περιοχών του DNA;
  4. Ποιες περιοχές του DNA θα πρέπει να χρησιμοποιήσετε για να συγκρίνετε οργανισμούς που έχουν στενή συγγένεια;
  5. Τι είδους γονίδια θα πρέπει να χρησιμοποιήσετε για να συγκρίνετε οργανισμούς που απέχουν εξελικτικά μεταξύ τους;
  6. Τι πρέπει να κάνετε αν συγκρίνετε δυο αλληλουχίες και η μια από αυτές έχει κενά που οφείλονται σε ελλείψεις (ή προσθήκες- insertions- στην άλλη αλληλουχία);
  7. Μπορείτε να σκεφτείτε τους λόγους για τους οποίους, στην περίπτωση που συγκρίνετε οργανισμούς που διαφέρουν πολύ, αυτή η μέθοδος, της απλής σύγκρισης των αριθμών των διαφορετικών νουκλεοτιδίων, μπορεί να μην λειτουργεί; Θυμηθείτε πως υποθέτουμε ότι χρειάζονται 20 εκ. έτη για να μεταλλαχθεί κάθε νουκλεοτίδιο σε μια αλληλουχία.
  8. Μπορείτε να σκεφτείτε άλλα αίτια για την πιθανή ακαταλληλότητα της μεθόδου για τη μέτρηση εξελικτικών αποστάσεων; Τι απλουστεύσεις έχουμε κάνει;
  9. Μπορείτε να σκεφτείτε γιατί, όταν μελετάμε οργανισμούς που απέχουν περισσότερο μεταξύ τους, είναι προτιμότερο να συγκρίνουμε αλληλουχίες αμινοξέων αντί για αλληλουχίες DNA;
  10. Σε αυτή την άσκηση, επικεντρωθήκαμε στον υπολογισμό του πότε τα πέντε είδη πρωτευόντων απέκλιναν το ένα από το άλλο (στην κλίμακα του Δέντρου). Συχνά πάντως δεν γνωρίζουμε ούτε τη διαδοχή, τη σειρά με την οποία τα είδη διαφοροποιήθηκαν το ένα από το άλλο (το σχήμα του Δέντρου). Πώς γνωρίζουμε, για παράδειγμα, ότι οι άνθρωποι και οι χιμπατζήδες είναι πιο στενοί συγγενείς μεταξύ τους από ότι οι γορίλες και οι χιμπατζήδες; Αν το τελευταίο ήταν αληθές, πώς θα άλλαζαν οι διαφορές στις αλληλουχίες (Πίνακα 4);

Ευχαριστίες

Η δραστηριότητα δημιουργήθηκε στα πλαίσια μιας ειδικής συνεργασίας του Ευρωπαϊκού Εργαστηρίου Μάθησης για τις Επιστήμες της Ζωής -European Learning Laboratory for the Life Sciences (ELLS)w1 – με τους συνεργάτες Ε- STAR του Ευρωπαϊκού Εργαστηρίου Μοριακής Βιολογίας – the European Molecular Biology Laboratory’s E-STAR Fellows -, που αποσκοπεί στη δημιουργία πόρων εκπαιδευτικού υλικού για τα Σχολεία. Η Κλεοπάτρα Κοζλόφσκι είχε την υποστήριξη μιας υποτροφίας E-STAR fellowship η οποία έχει θεσμοθετηθεί από το Πρόγραμμα πλαίσιο της Ευρωπαϊκής Ένωσης: Framework Programme 6 Marie Curie Host Fellowship for Early Stage Research Training, με αριθμό Σύμβασης MEST-CT-2004-504640.

Download

Download this article as a PDF

Web References

  • w1 – Το Ευρωπαϊκό Εργαστήριο Μάθησης για τις Επιστήμες της Ζωής -European Learning Laboratory for the Life Sciences (ELLS) – είναι ένα εκπαιδευτικό εργαστήρι που φέρνει τους εκπαιδευτικούς της δευτεροβάθμιας εκπαίδευσης σε επαφή με τα ερευνητικά εργαστήρια και τις πλέον σύγχρονες τεχνικές της μοριακής βιολογίας. Το ELLS δίνει επίσης την ευκαιρία στους επιστήμονες να δουλέψουν με εκπαιδευτικούς, με την ελπίδα να γεφυρώσει το χάσμα μεταξύ της έρευνας και του σχολείου που ολοένα διευρύνεται. Η δραστηριότητα που περιγράφεται σε αυτό το άρθρο σχεδιάστηκε ως εκπαιδευτικό υλικό για το πρόγραμμα. Για περισσότερες πληροφορίες σχετικά με το ELLS δες: www.embl.org/ells
  • w2 – Κατεβάστε όλους τους πίνακες που απαιτούνται για να ολοκληρώσουν οι μαθητές αυτή τη δραστηριότητα, μαζί με τις οδηγίες για τη διαδικασία βήμα προς βήμα και απαντήσεις στις ερωτήσεις κατανόησης, εδώ.

Resources

  • Ο ιστοχώρος US National Center for Biotechnology Information (NCBI) προσφέρει μια εισαγωγή στη φυλογενετική. Βλέπε: www.ncbi.nlm.nih.gov/About/primer/phylo.html
  • Για να μάθετε περισσότερα σχετικά με τη χρησιμοποίηση των πρωτεϊνικών αλληλουχιών για τη δόμηση φυλογενετικών δέντρων: http://users.rcn.com/jkimball.ma.ultranet/BiologyPages/T/Taxonomy.html#PhylogeneticTrees
  • Για να μάθετε πώς μια ομάδα επιστημόνων ανακατασκεύασε το νέο Δέντρο της Ζωής, ιχνηλατώντας την εξελικτική διαδρομή:
  • Το Διαδραστικό Δέντρο της Ζωής είναι ένα διαδικτυακό εργαλείο για την παρουσίαση και το χειρισμό των φυλογενετικών δέντρων. Για να μάθετε περισσότερα: http://itol.embl.de

Institution

EMBL

Review

Όταν σκεφτόμαστε την βιοπληροφορική φανταζόμαστε ίσως τεράστιους ηλεκτρονικούς υπολογιστές και μηχανήματα προσδιορισμού αλληλουχιών, οι μέθοδοι όμως αυτής της νέας επιστήμης μπορούν να παρουσιαστούν μέσα από απλές δραστηριότητες στην τάξη, που μπορούν να διεξαχθούν χρησιμοποιώντας μολύβι και χαρτί, όπως κάνει η Κλεοπάτρα Κοζλόφσκι σε αυτό το άρθρο.

Η πρόκληση που μας απευθύνει η συγγραφέας είναι η κατασκευή γενεαλογικού δέντρου των ανθρώπων και άλλων πρωτευόντων, βασιζόμενου στις γενετικές διαφορές που παρουσιάζουν μεταξύ τους μικρές (φανταστικές) αλληλουχίες DNA. Η προτεινόμενη δραστηριότητα μπορεί να πραγματοποιηθεί στη δευτεροβάθμια εκπαίδευση προσφέροντας ωφέλεια και ευχαρίστηση αποσκοπώντας στην προσέγγιση κάποιων ιδιαίτερων ζητημάτων της Βιολογίας, όπως η χρήση των μοριακών ρολογιών στη μελέτη της Εξέλιξης.

Αυτό το άρθρο απευθύνεται σε καθηγητές φυσικών επιστημών, που μπορούν να βρουν χρήσιμες ασκήσεις κατανόησης στο τέλος του κειμένου. Οι μαθητές μπορούν να επωφεληθούν από τις ερωτήσεις για να εμβαθύνουν στην κατανόηση του θέματος. Οι αναφερόμενες διαδικτυακές πηγές παρέχουν επιπλέον πληροφορίες και υλικό.


Giulia Realdon, Ιταλία




License

CC-BY-NC-SA