Menu - Upper Menu

Languages:
AlbanianBulgarianCatalanCroatianCzechDanishDutchEnglishEstonianFrenchFinnishGalicianGermanGreekHungarianItalianLatvianLithuanianMacedonianMaltesePolishPortugueseRomanianRussianSerbianSlovakSloveneSpanishSwedishTurkishUkrainian
Home » Issue 17 » Bioinformática com papel e lápis: construção de uma árvore filogenética

Bioinformática com papel e lápis: construção de uma árvore filogenética

Traduzido por: Artur Melo

image
Imagem cortesia de hometowncd / iStockphoto

A bioinformática é normalmente estudada com computadores potentes. Com a ajuda de Cleopatra Kozlowski, no entanto, pode investigar a nossa ascendência primata – armado apenas com um lápis e um papel.

Como resultado de avanços tecnológicos recentes, é relativamente rápido e fácil determinar uma sequência de ADN ou de uma proteína. Estas sequências por si só, como é óbvio, não são significativas: GAATCCA, por exemplo. Precisamos saber o que essas sequências significam. Que proteínas são codificadas por essa sequência; codificará a sequência realmente uma proteína? Que influência tem uma pequena alteração na sequência de ADN, na estrutura da proteína codificada? Que função desempenha essa proteína na célula? E, é claro, o que pode a sequência de ADN dizer-nos acerca da nossa história evolutiva?

Estas e outras importantes questões biológicas podem ser abordadas pela bioinformática: essencialmente, pela comparação de sequências de ADN e de proteínas – por exemplo, comparando sequências recentemente descobertas com sequências para as quais já temos bastante informação (será que têm uma função semelhante?) ou comparando sequências semelhantes em diferentes espécies.

A bioinformática é, evidentemente, realizada habitualmente com o auxílio de um computador potente. No entanto, é bastante fácil deixar que o computador realize todo o trabalho sem perceber os príncipios subjacentes envolvidos. Por isso, estas actividades estão planeadas para ser feitas em papel, para permitir aos alunos perceber como a análise bioinformática funciona.

Este artigo inclui uma actividade de um grupo de quatro. As duas actividades introdutórias (‘Gene finding’ e ‘Mutations’) e a actividade de conclusão (‘Mobile DNA’) podem ser descarregadas no website do ‘European Learning Laboratory for the Life Sciences (ELLS)w1. Todos os quadros necessários para os alunos realizarem esta actividade, assim como o procedimento passo-a-passo e as respostas às questões, podem ser descarregadas no website da Science in Schoolw2.

Construindo uma árvore filogenética

A acumulação de mutações provoca a alteração das sequências de ADN ao longo das gerações. A actividade que se segue demonstra como isso pode ser usado para deduzir relações evolutivas entre organismos. Demora cerca de 90 minutos e apenas é preciso um lápis e os quadros, que podem ser obtidos no website da Science in Schoolw2.

Introdução

Pense como iria classificar vários animais. Tradicionalmente são usadas diferenças físicas entre os organismos para deduzir relações evolutivas entre eles, por exemplo, se um organismo tem coluna vertebral ou se tem asas. No entanto, este método pode originar problemas. Por exemplo, aves, morcegos e insectos têm asas, mas estarão intimamente relacionados? Como podemos medir há quanto tempo os organismos divergiram a partir de um ancestral comum?

Sabemos, a partir de estudos de sequências de ADN, que as mutações no ADN ocorrem ao acaso a uma taxa muito baixa e são transmitidas dos pais para os filhos. Assim, se assumirmos que todos os organismos têm um ancestral comum, podemos usar as diferenças nas sequências homólogas para medir quanto tempo decorreu desde que os organismos divergiram. Por outras palavras, quanto mais tempo passou desde que duas espécies divergiram a partir de um ancestral comum, mais diferenças haverá nas suas sequências de ADN.

Define-se sequências homólogas como sequências que em dois organismos têm uma origem comum. Na realidade, não há provas seguras que quaisquer duas sequências são homólogas (não estávamos lá para ver o ADN a mudar ao longo do tempo) mas se forem suficientemente semelhantes, assume-se normalmente que são ‘homólogas’. Para conhecer quão semelhantes são duas sequências, precisamos de as alinhar correctamente (isto não faz parte desta actividade).

image
: Árvore da vida de Haeckel publicada em The Evolution of Man (1879). Clique na imagem para ampliar
Imagem de domínio publico; Fonte da Imagem: Wikimedia Commons

Tenha em atenção que regiões diferentes de ADN – regiões codificantes e não-codificantes – evoluem a taxas diferentes. Geralmente, as regiões codificantes evoluem mais lentamente, porque uma mutação que provoca alterações numa proteína é normalmente mais agressiva para o organismo – é menos provável que sobreviva e produza descendência. Este aspecto é discutido na actividade ‘Mobile DNA’..

Para ilustrar o conceito de homologia, podemos usar o exemplo da filologia – o estudo da evolução das línguas. De facto, há muitas semelhanças entre os métodos usados no estudo da evolução da língua e dos organismos.

Figura 1: A árvore da linguagem Indo-Europeia. Veja que apesar do indiano, germânico, românico e muitas outras línguas europeias pertencerem a esta família, o finlandês, o estónio e o húngaro não pertencem: estas pertencem ao grupo de línguas do Urais. Clique na imagem para ampliar
Origem: www.linguatics.com/indoeuropean_languages.htm

Usar as diferenças entre sequências de fragmentos de ADN é um pouco como comparar uma palavra com o mesmo significado em diferentes línguas, para verificar a proximidade da sua relação.

   Arménio gatz
   Basco katu
   Holandês kat
   Inglês cat
   Estónio kass
   Finlandês kissa
   Islandês kottur
   Italiano gatto
   Norueguês katt
   Polaco kot
   Português gato
   Russo kot
   Espanhol gato
   Sueco katt
Quadro 1: Lista de ‘gato’ em línguas Indo-Europeias
Origem: http://cats-cat.blogspot.com

Podemos ver que as palavras para ‘gato’ em Italiano, Espanhol e Português são quase iguais: gatto, gato e gato. Tanto em Sueco como em Norueguês a palavra é ‘katt’ mas em Finlandês é diferente: ‘kissa’. Apesar de, tal como a Suécia e a Noruega, a Finlândia ser um país nórdico, a palavra finlandesa para ‘gato’ é mais parecida com a palavra da Estónia, ‘kass’. De facto, as duas línguas estão intimamente relacionadas. Assim podemos aprender um pouco sobre relações entre línguas estudando como as palavras se foram modificando ao longo do tempo.

Construindo a árvore filogenética dos primatas

image
Imagem cortesia de Stephan Franz Xaver Dietl / pixelio.de

Nesta actividade, vamos construir uma árvore filogenética usando cinco sequências de ADN homólogas de primatas. Como as sequências foram preparadas, não podemos deduzir nenhuma estimativa da distância genética; para criar uma árvore filogenética significativa a partir de dados reais precisávamos de sequências bastante mais longas. Não obstante, as sequências fictícias (no Quadro 2) foram seleccionadas para fornecer uma perspectiva precisa das relações entre os primatas.

Nota: todos os quadros necessários para os alunos completarem esta actividade podem ser obtidos no website da Science in Schoolw2.


Primata Sequence
Neandertal (n) TGGTCCTGCAGTCCTCTCCTGGCGCCCCGGGCGCGAGCGGTTGTCC
Humano (h) TGGTCCTGCTGTCCTCTCCTGGCGCCCTGGGCGCGAGCGGATGTCC
Chimpanzé (c) TGATCCTGCAGTCCTCTTCTGGCGCCCTGGGCGCGTGCGGTTGTCC
Gorila (g) TGGACCTGCAGTCATCTTCTGCCCGCCCGAGCGCTTGCCGATGTCC
Orangotango (o) ACAACCTGCACTCCTATTCTGCCGAGCCGGGCGCGTGGCAAAGTCC
Quadro 2: Cinco sequências de ADN de primatas
  1. Conte o número de diferenças entre cada par de sequências, e registe-as no Quadro 4. Será mais fácil de fazer se comparar cada sequência lado a lado. Por exemplo, os neandertais e os humanos diferem em 3 nucleótidos na sequência (Quadro 3a) enquanto chimpanzés e gorilas diferem em 11 pontos (Quadro 3b).

Neandertal TGGTCCTGCAGTCCTCTCCTGGCGCCCCGGGCGCGAGCGGTTGTCC
Humano TGGTCCTGCTGTCCTCTCCTGGCGCCCTGGGCGCGAGCGGATGTCC
Quadro 3a: Comparação entre as sequências de um neandertal e de um humano
Chimpanzé TGATCCTGCAGTCCTCTTCTGGCGCCCTGGGCGCGTGCGGTTGTCC
Gorila TGGACCTGCAGTCATCTTCTGCCCGCCCGAGCGCTTGCCGATGTCC
Quadro 3b: Comparação entre as sequências do chimpanzé e do gorila

Quadros comparativos para todos os pares de espécies, e o quadro preenchido com as diferenças nas sequências (Quadro 4), podem ser obtidos no website da Science in Schoolw2.

  Neanderthal Human Chimpanzee Gorilla Orangutan
Neandertal 0 3      
Humano 3 0      
Chimpanzé     0 11  
Gorila     11 0  
Orangotango         0
Quadro 4: Diferenças de sequências entre primatas

O número de diferenças de nucleótidos entre duas sequências, dividido pelo número total de nucleótidos em cada sequência (neste caso, 46) dá-nos a distância proporcional entre as duas sequências.

  1. Considere as duas espécies com as sequências mais semelhantes: neandertal e humano. No quadro 5, registe o número de diferenças nos nucleótidos (3) e a diferença proporcional (3/46 = 0.065).

  Diferenças Diferença proporcional
Neandertal e humano 3 3/46 = 0.065
Neandertal / humano e chimpanzé    
Neandertal / humano / chimpanzé e gorila    
Neandertal / humano / chimpanzé/ gorila e orangotango    
Quadro 5: Distâncias evolutivas entre ancestrais dos primatas e primatas

Assume-se que a ‘sequência média’ de duas espécies corresponde ao seu ancestral. Neste exercício, não calculamos directamente a sequência média de, por exemplo, neandertais e humanos, mas a distância evolutiva entre o ancestral de neandertais/humanos e todos os outros primatas do grupo.

  1. Calcule a distância entre a sequência média de neandertais e humanos, e as outras espécies de primatas e registe os resultados no Quadro 6a.

    Há quatro diferenças entre o neandertal e o chimpanzé, e cinco diferenças entre humano e chimpanzé. Assim, a distância média entre neandertal/humano e chimpanzé é 4.5.

    Há 11 diferenças entre neandertal e gorila, e 12 diferenças entre humano e gorila. Assim, a distância média entre neandertal/humano e gorila é 11.5.

 

Neandertal / humano Chimpanzé Gorila Orangotango
Neandertal/ humano 0 (4+5)/2 = 4.5 (11+12)/2=11.5  
Chimpanzé (4+5)/2 = 4.5 0    
Gorila (11+12)/2=11.5   0  
Orangotango       0
Quadro 6a: Diferenças na sequências entre o ancestral neandertal/humano e outros primatas
  1. Da mesma forma, estas distâncias podem ser transformadas em diferenças proporcionais, dividindo pelo número de nucleótidos em cada sequência (46). Calcule as distâncias proporcionais entre a sequência média de neandertais/humanos, e as outras espécies de primatas. Registe os valores no Quadro 5.

    Para os chimpanzés, a distância proporcional do ancestral neandertal/humano é 4.5/46 = 0.098.

Usando o Quadro 5, pode começar a construir a árvore evolutiva.

  1. Ligue os neandertais e os humanos com uma linha. O comprimento do ramo deve corresponder ao tempo que decorreu desde que humanos e neandertais divergiram do seu ancestral.

    Consideremos que são necessários 20 milhões de anos para que cada um dos nucleótidos desta sequência de ADN se altere. Assim, para que a sequência de ADN se altere 0.065, seriam necessários 0.065*20 milhões = 1.3 milhões de anos. O ramo deve, por isso, medir 1.3 milhões de anos na escala do tempo(ver Figura 2).

  2. Para calcular há quanto tempo o ancestral do chimpanzé divergiu do ancestral dos humanos (o comprimento do ramo), some as diferenças proporcionais no Quadro 5.

    Recorde que a distância proporcional entre o ancestral neandertal/humano e o chimpanzé era 0.098. Assim, chimpanzés, humanos e neandertais divergiram a partir de um ancestral comum há:

    (0.065 + 0.098) * 20 milhões

    = 0.163 * 20 milhões

    = 3.3 milhões de anos.

Figure 2: Incomplete phylogenetic tree Image courtesy of Nicola Graf Figura 2: Árvore filogenética incompleta
Imagem cortesia de Nicola Graf

  1. Continue os cálculos. Repita os passos 3 a 6 para calcular há quanto tempo o ancestral neandertal / humano / chimpanzé divergiu do gorila e do orangotango. Depois calcule há quanto tempo o ancestral neandertal / humano/ chimpanzé / gorila divergiu do orangotango. Registe os resultados no Quadro 5.

    Se precisar de ajuda, pode descarregar o procedimento passo-a-passo no website da Science in School.

  2. Use o Quadro 5 completo para terminar a árvore filogenética, como se mostra abaixo.

Figure 3: Complete phylogenetic tree Image courtesy of nicola Graf Figura 3: Árvore filogenética completa
Imagem cortesia de Nicola Graf

Questões

Seguem-se algumas questões que pode usar para avaliar se os seus alunos compreenderam esta actividade. As respostas podem ser obtidas no website da Science in Schoolw2.

  1. Na sua árvore filogenética, há quantos anos divergiram os gorilas e os humanos de um ancestral comum? E os orangotangos e humanos?

  2. Pode verificar se estas e outras estimativas na sua árvore estão correctas?

  3. Por que podem as árvores filogenéticas construídas a partir de diferentes zonas de ADN ser diferentes?

  4. Que regiões de ADN deve usar para comparar organismos que estão intimamente realcionados?

  5. Que tipo de genes deve usar para comparar organismos que estão evolutivamente distantes uns dos outros.

  6. O que deve fazer se estiver a comparar duas sequências, mas uma delas apresentar falhas devidas a delecções (ou inserções na outra sequência)?

  7. Consegue apresentar razões pelas quais este método de comparação simples do número de diferenças entre os nucleótidos pode não funcionar se estiver a comparar organismos que são muito diferentes? Recorde que assumimos que são necessários 20 milhões de anos para que cada nucleótido numa sequência sofra mutação.

  8. Pode apresentar outros motivos que justifiquem que poderá não ser muito correcto usar este método para determinar distâncias evolutivas? Que simplificações foram feitas?

  9. Pode propor razões que justifiquem que se estiver a estudar organismos mais distantes, é melhor comparar as sequências de aminoácidos em vez das sequências de ADN?

  10. Neste exercício, concentrámo-nos em descobrir quando as cinco espécies de primatas divergiram umas das outras (a escala da árvore). É frequente, no entanto, não sabermos sequer a ordem pela qual as espécies divergiram entre si (a forma da árvore). Como sabemos, por exemplo, que os humanos e os chimpanzés estão evolutivamente mais próximos que os gorilas e os chimpanzés? Se isto fosse verdade, que alterações haveria nas diferenças de sequências(Quadro 4)?

Agradecimento

Esta actividade foi desenvolvida numa colaboração especial entre o ‘European Learning laboratory for the Life Sciences (ELLS)w1 e o ‘European Molecular Biology Laboratory’s E-STAR Fellows’ para criar recursos educativos para as escolas. Cleopatra Kozlowski foi apoiada pela E-STAR fundada pela ‘European Commission’s Framework Programme 6 Marie Curie Host Fellowship for Early Stage Research Training’, com o contrato número MEST-CT-2004-504640.

Referências da Internet

w1 – O ‘European Learning Laboratory for the Life Sciences (ELLS)’ é um estabelecimento de ensino que recebe professores do ensino secundário no laboratório de investigação, para um encontro único com as técnicas de biologia molecular recentes. O ELLS também oferece aos cientistas oportunidade de trabalhar com professores, ajudando interligar a crescente separação entre a investigação e as escolas. A actividade descrita neste artigo foi planificada como recurso didáctico para o programa de desenvolvimento profissional do ELLS, para professores europeus. Para mais informação sobre o ELLS, aqui: www.embl.org/ells

w2 – Descarregue todos os quadros necessários para os alunos completarem esta actividade, o procedimento passo-a-passo e as respostas às questões, aqui.

Recursos

O website do ‘US National Center for Biotechnology Information (NCBI)’ oferece uma introdução à filogenia. Ver: www.ncbi.nlm.nih.gov/About/primer/phylo.html

Para saber mais sobre a utilização de sequências de proteínas na criação de árvores filogenéticas, ver: http://users.rcn.com/jkimball.ma.ultranet/BiologyPages/T/Taxonomy.html#PhylogeneticTrees

Para saber como um grupo de cientistas recriou a nova árvore da vida, delineando o percurso da evolução, ver:

Hodge R (2006) A new tree of life. Science in School 2: 17-19. www.scienceinschool.org/2006/issue2/tree

A Árvore da Vida Interactiva é uma ferramenta online para a representação e manipulação de árvores filogenéticas. Para saber mais, ver: http://itol.embl.de

Para pesquisar outros artigos sobre evolução na Science in School, ver: www.scienceinschool.org/evolution


Opinião

Quando pensamos na bioinformática, provavelmente imaginamos enormes computadores e equipamento de sequenciação, mas os métodos desta ciência recente podem ser apresentados como actividades didáticas simples, a realizar com papel e lápis, como Cleopatra Kozlowski faz neste artigo.

A autora desafia-nos a construir a árvore filogenética de humanos e outros primatas tendo como base as diferenças genéticas entre pequenas sequências de ADN (fictícias). A actividade proposta pode ser proveitosamente (e agradavelmente) explorada em escolas secundárias para abordar alguns tópicos de biologia tais como a utilização de relógios moleculares no estudo da evolução.

O artigo está orientado para professores de ciências, incluindo exercícios de avaliação no final do texto; os alunos podem usar as questões para aprofundar o conhecimento sobre o assunto. As referências web fornecem mais informações e recursos.

Giulia Realdon, Itália


Copyright: attribution Copyright: non-commercial Copyright: share and share alike No endorsement


Return to top of page

Support the print journal

Learn more

Menu - My Account

Science in School e-newsletter